ID: 1201555100

View in Genome Browser
Species Human (GRCh38)
Location Y:15259012-15259034
Sequence ATAATGCTTCATGCACTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201555100_1201555108 13 Left 1201555100 Y:15259012-15259034 CCTTCAAGTGCATGAAGCATTAT No data
Right 1201555108 Y:15259048-15259070 TCTGTTAAACTCTGGGGGAAAGG No data
1201555100_1201555103 -10 Left 1201555100 Y:15259012-15259034 CCTTCAAGTGCATGAAGCATTAT No data
Right 1201555103 Y:15259025-15259047 GAAGCATTATATAAGGAAAAGGG No data
1201555100_1201555104 5 Left 1201555100 Y:15259012-15259034 CCTTCAAGTGCATGAAGCATTAT No data
Right 1201555104 Y:15259040-15259062 GAAAAGGGTCTGTTAAACTCTGG No data
1201555100_1201555107 8 Left 1201555100 Y:15259012-15259034 CCTTCAAGTGCATGAAGCATTAT No data
Right 1201555107 Y:15259043-15259065 AAGGGTCTGTTAAACTCTGGGGG No data
1201555100_1201555105 6 Left 1201555100 Y:15259012-15259034 CCTTCAAGTGCATGAAGCATTAT No data
Right 1201555105 Y:15259041-15259063 AAAAGGGTCTGTTAAACTCTGGG No data
1201555100_1201555106 7 Left 1201555100 Y:15259012-15259034 CCTTCAAGTGCATGAAGCATTAT No data
Right 1201555106 Y:15259042-15259064 AAAGGGTCTGTTAAACTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201555100 Original CRISPR ATAATGCTTCATGCACTTGA AGG (reversed) Intergenic
No off target data available for this crispr