ID: 1201555107

View in Genome Browser
Species Human (GRCh38)
Location Y:15259043-15259065
Sequence AAGGGTCTGTTAAACTCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201555100_1201555107 8 Left 1201555100 Y:15259012-15259034 CCTTCAAGTGCATGAAGCATTAT No data
Right 1201555107 Y:15259043-15259065 AAGGGTCTGTTAAACTCTGGGGG No data
1201555099_1201555107 18 Left 1201555099 Y:15259002-15259024 CCTTTCTAATCCTTCAAGTGCAT No data
Right 1201555107 Y:15259043-15259065 AAGGGTCTGTTAAACTCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201555107 Original CRISPR AAGGGTCTGTTAAACTCTGG GGG Intergenic
No off target data available for this crispr