ID: 1201571521

View in Genome Browser
Species Human (GRCh38)
Location Y:15420620-15420642
Sequence CGGGGCAGAGACTCTGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201571521_1201571525 -5 Left 1201571521 Y:15420620-15420642 CCAGCAGCAGAGTCTCTGCCCCG No data
Right 1201571525 Y:15420638-15420660 CCCCGGAGAATTACACTCCTGGG No data
1201571521_1201571523 -6 Left 1201571521 Y:15420620-15420642 CCAGCAGCAGAGTCTCTGCCCCG No data
Right 1201571523 Y:15420637-15420659 GCCCCGGAGAATTACACTCCTGG No data
1201571521_1201571528 7 Left 1201571521 Y:15420620-15420642 CCAGCAGCAGAGTCTCTGCCCCG No data
Right 1201571528 Y:15420650-15420672 ACACTCCTGGGATTCCAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201571521 Original CRISPR CGGGGCAGAGACTCTGCTGC TGG (reversed) Intergenic
No off target data available for this crispr