ID: 1201571651

View in Genome Browser
Species Human (GRCh38)
Location Y:15421796-15421818
Sequence AAGGTCAGTGTTTTTGAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 2, 1: 0, 2: 1, 3: 22, 4: 289}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201571651_1201571658 27 Left 1201571651 Y:15421796-15421818 CCTTATTCAAAAACACTGACCTT 0: 2
1: 0
2: 1
3: 22
4: 289
Right 1201571658 Y:15421846-15421868 ACTTCTGTGAAGGCAAAGGAAGG No data
1201571651_1201571653 -4 Left 1201571651 Y:15421796-15421818 CCTTATTCAAAAACACTGACCTT 0: 2
1: 0
2: 1
3: 22
4: 289
Right 1201571653 Y:15421815-15421837 CCTTTTAAAGATCTCACATCTGG 0: 2
1: 0
2: 1
3: 13
4: 209
1201571651_1201571655 17 Left 1201571651 Y:15421796-15421818 CCTTATTCAAAAACACTGACCTT 0: 2
1: 0
2: 1
3: 22
4: 289
Right 1201571655 Y:15421836-15421858 GGGCCACAGAACTTCTGTGAAGG No data
1201571651_1201571657 23 Left 1201571651 Y:15421796-15421818 CCTTATTCAAAAACACTGACCTT 0: 2
1: 0
2: 1
3: 22
4: 289
Right 1201571657 Y:15421842-15421864 CAGAACTTCTGTGAAGGCAAAGG No data
1201571651_1201571654 -3 Left 1201571651 Y:15421796-15421818 CCTTATTCAAAAACACTGACCTT 0: 2
1: 0
2: 1
3: 22
4: 289
Right 1201571654 Y:15421816-15421838 CTTTTAAAGATCTCACATCTGGG 0: 2
1: 0
2: 4
3: 35
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201571651 Original CRISPR AAGGTCAGTGTTTTTGAATA AGG (reversed) Intergenic
901120177 1:6885345-6885367 AAGGTCAGTGTGTGTGTGTAGGG + Intronic
903742346 1:25565578-25565600 CAGGTCTGTGTTTATGAACAGGG + Intronic
904309335 1:29617586-29617608 AAGGTCAGTGTGTTTGAGGGTGG + Intergenic
905488555 1:38325540-38325562 AATGTGACTGTTTTTGAAGATGG - Intergenic
906789885 1:48650001-48650023 AAGGTCAGTGGTTGAGAAAATGG - Intronic
906882905 1:49611754-49611776 AAGGTCAATGAATCTGAATAAGG + Intronic
908007068 1:59738080-59738102 AAGGTTCTTCTTTTTGAATAGGG - Intronic
908916036 1:69127639-69127661 AAAGTTAGTATTTTTAAATAGGG - Intergenic
909195492 1:72616595-72616617 AATTTCAATGTTTTTGAATTTGG + Intergenic
909788972 1:79648999-79649021 AAAGTCAGTTTTACTGAATAGGG - Intergenic
909802237 1:79824416-79824438 AAGGTCTTTGTCTTTGAATTAGG - Intergenic
911173045 1:94790397-94790419 AAGGTCAGTCTTTTCTATTATGG - Intergenic
912985950 1:114430599-114430621 AAAGTCAGTGTTATTAAATTGGG + Intronic
915307137 1:154987010-154987032 AGGGTCTGTGTTTTGGAGTAAGG - Intronic
915366282 1:155318497-155318519 AAGGACTGTGTGTATGAATATGG + Intronic
916929296 1:169558466-169558488 AAGTTTAGTGTTTTGAAATATGG + Intronic
916950498 1:169775649-169775671 TAGGGCAGTGTTGTTGAAAAGGG - Intronic
917674695 1:177307627-177307649 AAGGTTAGTATTTTTGAAATTGG + Intergenic
919019195 1:192082081-192082103 AAAATCAGTGTTTTTAAATTAGG + Intergenic
919244245 1:194958200-194958222 AAGGTGTGTGTTTATTAATATGG - Intergenic
919390918 1:196984843-196984865 AAGGTCAGTCTTGGTGACTATGG - Intronic
919662822 1:200263962-200263984 AAGGTCAGTTCTTCAGAATAGGG + Intergenic
920247068 1:204596107-204596129 AAGGTCAGTCTCTTTGGATTTGG + Intergenic
921548517 1:216503184-216503206 AAGGGCAGTGTTTATCAATTTGG + Intergenic
921906414 1:220500070-220500092 AAGGAAAGTGTTCTTGGATATGG + Intergenic
923637223 1:235710903-235710925 AATGTCAGTGTTTTTTCATGTGG - Intronic
1062829434 10:595745-595767 AAAGTCAGGTTTTTTCAATAAGG + Intronic
1063706831 10:8438905-8438927 AAGCTCAGTGATGTTGGATAGGG + Intergenic
1064225753 10:13483265-13483287 CAGGTCAGTGTTTTTCAAACTGG - Intronic
1064353076 10:14594704-14594726 ATGATCAGTGTTTTTCAACAAGG - Intronic
1065935219 10:30515171-30515193 AAGGGAAGTGTTTGTCAATATGG + Intergenic
1067494954 10:46753546-46753568 TAGGGCAGTGTTTTTGAGCAGGG - Intergenic
1067599702 10:47586850-47586872 TAGGGCAGTGTTTTTGAGCAGGG + Intergenic
1068330034 10:55552036-55552058 CAATTCAGTGTTTTTGCATATGG - Intronic
1068862282 10:61859618-61859640 AAGGTCATTGTTTTTACAAATGG + Intergenic
1069780264 10:70950886-70950908 AAGGCCATTGTTTTTCAAGAGGG - Intergenic
1071852656 10:89590615-89590637 AAATTCAGTGTATTTGTATACGG - Intronic
1072387150 10:94942350-94942372 AAGGTCAGTGATATGGAGTAGGG - Intronic
1072844685 10:98816737-98816759 TAGGACAGTGTTTTTAAATCAGG - Intronic
1073362307 10:102909643-102909665 AAGGTGACTGTATTTGAAGATGG + Intergenic
1073523184 10:104154659-104154681 AATCTCAGTGTTTTTAAAGAAGG - Intronic
1073558045 10:104472522-104472544 AATGTCAATGTATTTGAATTTGG + Intergenic
1073754792 10:106569989-106570011 AAGGTCTGTGTAAGTGAATAGGG + Intergenic
1073991827 10:109269972-109269994 GAGGAGAGTGTTTTTGACTAGGG - Intergenic
1074558597 10:114514955-114514977 AAGGTCAGTGCATTTGCATTTGG - Intronic
1075260230 10:120957172-120957194 AAGGTCATTGGGTTTGGATAAGG - Intergenic
1075517728 10:123122136-123122158 AAGGTCACTTTTTTTGCTTAAGG + Intergenic
1078290702 11:10007548-10007570 AAGGTCAGGGTTGTTTCATAGGG - Intronic
1079846256 11:25472968-25472990 AACTTCAGTATTTTTCAATAAGG - Intergenic
1080734427 11:34998406-34998428 TAGGTCAGTGTCTTTAAAGAAGG + Intronic
1081033500 11:38114351-38114373 AACGTTAGTGTTTTGTAATAGGG + Intergenic
1082005607 11:47417492-47417514 AGGGTGTGTGGTTTTGAATAAGG - Intergenic
1082930330 11:58596575-58596597 AAGATGAGTGCTTTTGAACAGGG - Intronic
1082959169 11:58902573-58902595 AAGGCCAGTGTTTATGGAAAGGG - Intronic
1082987010 11:59177725-59177747 AAGGACAGTGTTTCAGAAGAAGG - Intronic
1083190814 11:61050941-61050963 AAGGTTAGGGTTATTTAATAAGG - Intergenic
1086400776 11:86459579-86459601 ATGGTCAGGGTTTTTTTATAAGG - Intronic
1086403383 11:86479469-86479491 ATGTTCAGTGATTTTAAATAAGG - Intronic
1086439946 11:86818788-86818810 AAAGACAGTGTCTTTGAATGAGG + Intronic
1087733179 11:101801479-101801501 GAGGTGACTGTTTTTGACTAGGG - Intronic
1088046866 11:105463398-105463420 AATGTCATTGCTTTTGGATAGGG - Intergenic
1088422445 11:109664049-109664071 AAGCTCAATGTTTCTGAAAAAGG + Intergenic
1088555963 11:111060997-111061019 AAGGTCTGTCTTTTGGAAAAAGG - Intergenic
1088930824 11:114349070-114349092 AACTTCAGTGTTTTATAATAGGG - Intergenic
1088934471 11:114385109-114385131 CAGGTTAGGGTTTTTGAATAAGG + Intergenic
1093022835 12:14219203-14219225 AACTTCAGTGTTTTATAATAGGG + Intergenic
1093081528 12:14817251-14817273 AAGGTTTATGTTTTTGCATATGG + Intronic
1095135209 12:38592620-38592642 AAGGTAAGTGCTTTTTGATAGGG - Intergenic
1096220940 12:49827976-49827998 AAGGTCAGTGCTTTCAAAGAGGG + Intronic
1096998147 12:55853158-55853180 ATGGTCAGTGTTTTGGATTTTGG - Intergenic
1099631931 12:85160631-85160653 ATTTTCATTGTTTTTGAATAAGG - Exonic
1100287130 12:93177587-93177609 AATGTGACTGTCTTTGAATATGG - Intergenic
1100331250 12:93584393-93584415 AAAGTCATTGTTTTGGACTAAGG - Intergenic
1100598803 12:96094496-96094518 AAGGGCAGTGGTTTTCAATGGGG + Intergenic
1100828367 12:98495618-98495640 AAGGTGAATGTTTTTGATTTGGG - Intronic
1101618714 12:106362706-106362728 AATGTGACTGTTTTTGAAGATGG - Intronic
1105012209 12:132763191-132763213 AGGGTCAGTAATTTTGAAGATGG + Intergenic
1107452728 13:40525819-40525841 TAGGTCCATGTTTTTGCATATGG - Intergenic
1107911996 13:45114284-45114306 AAGGATAGTGGTTTTGATTAGGG - Intergenic
1107969756 13:45630034-45630056 AAGGTCATTATTTTTGCATGAGG + Intergenic
1111395145 13:87657173-87657195 GAGGTAAGTGTCTTTGAATTTGG + Intergenic
1114990453 14:28280431-28280453 AAAATCAGTGTTTTTAAATCAGG - Intergenic
1115747457 14:36452021-36452043 AAGGCCAGTGTTATTGTCTATGG + Intergenic
1117137167 14:52747401-52747423 AAGGTCATTGATTTTGAAACTGG + Intronic
1119241831 14:73066736-73066758 AAGTTTAGTTTTATTGAATATGG + Intronic
1120295018 14:82628950-82628972 AAGGTCAGTGTTTATGCCTGTGG + Intergenic
1120308267 14:82797970-82797992 TACGTCAGTGTTTTCTAATATGG + Intergenic
1125661253 15:41396597-41396619 AAGTGAAGTGTTTTTGAAAATGG - Exonic
1126836942 15:52678153-52678175 AAGGTCCGGGTATTAGAATAGGG - Intronic
1130702892 15:86203409-86203431 AAGGTCATTGTTTCTGAAACTGG + Intronic
1130755093 15:86754785-86754807 AAGGTCAGTGCCTCTGAACAGGG - Intronic
1130955259 15:88622898-88622920 AAGGTCAGGGTGTTTGGAAAAGG + Intronic
1131530673 15:93189100-93189122 AAGGTAGTTGTTTCTGAATAGGG + Intergenic
1131676724 15:94677456-94677478 TATGTCAGTGTTTTTGAAACTGG + Intergenic
1131865932 15:96709818-96709840 AAGGTCAAAGTTTTTTAAAATGG - Intergenic
1134398054 16:13883540-13883562 AAGGCCACTGTTTCTGAATGGGG + Intergenic
1137918893 16:52465329-52465351 AAAGGCAGTGTTTTAAAATAGGG + Intronic
1139307922 16:66003772-66003794 ATGGTCAGTGATAATGAATAGGG + Intergenic
1139541389 16:67619912-67619934 AAAGTCACTGTTTTAGTATAAGG + Intronic
1140151611 16:72372874-72372896 AAGGGCAGGGTTTGTAAATATGG + Intergenic
1144202184 17:12951650-12951672 GAGGTCAGTGTCTTTGAACCAGG + Intronic
1146556765 17:33831655-33831677 ACTGTCAGTGTTTGTGCATATGG + Intronic
1146720974 17:35123194-35123216 AAATTCAGAATTTTTGAATAAGG + Intronic
1147404645 17:40202193-40202215 AAGGAAAGTGTTTTTAAAAATGG - Intergenic
1148456687 17:47814893-47814915 AGGGTCAGGGTTTTGGAAGAGGG + Intronic
1149390770 17:56188316-56188338 AATGTCATTGATTTTGAAAAAGG + Intronic
1150099166 17:62407051-62407073 AAGATGGGTATTTTTGAATATGG - Exonic
1150178898 17:63093313-63093335 AAGGTCCGTGTTTTTGCATTTGG + Intronic
1153014747 18:573485-573507 AATGTCAGTGTCTTTAAAAAGGG + Intergenic
1153142006 18:1983670-1983692 AAGGTCTCAGTTTTTGGATATGG + Intergenic
1153992903 18:10415755-10415777 AAGGACAGTGTTTTTGCCTTCGG + Intergenic
1154931739 18:21004936-21004958 AGGGTCAGTTTTTGTGACTAAGG - Intronic
1154972064 18:21419836-21419858 AAAGTTCATGTTTTTGAATATGG - Intronic
1156187703 18:34682536-34682558 GATGTCAGTGTTTTAGAATTTGG + Intronic
1156759858 18:40575224-40575246 AAGGACAGTGTGTTTGAAGGAGG + Intergenic
1157747784 18:50151677-50151699 AAATTCAGTGTTTTAGAAGAAGG - Intronic
1158234173 18:55294524-55294546 AAGGACAGTTTTTCTGAAAAAGG - Intronic
1158657831 18:59356760-59356782 AAGGTTAAGGTTTTTGAAAAAGG - Intronic
1159590679 18:70332092-70332114 TAGATCAGGGTTTATGAATAGGG + Intergenic
1160040648 18:75342313-75342335 ATGGTCAGTGTTTTTCAACCTGG - Intergenic
1161738741 19:6007478-6007500 AGGGTCAGACTGTTTGAATAGGG - Intronic
1162357725 19:10196532-10196554 AAGTTTTGTGTTTTTGTATATGG - Intronic
1162362023 19:10226308-10226330 AAGGTCTGTGTCCTTGAAGATGG - Intronic
1164434143 19:28214411-28214433 AAGGTCACTGTTTTTAATTTTGG - Intergenic
1166218935 19:41353270-41353292 AAGGTGGGTGGTCTTGAATAGGG + Exonic
1167662398 19:50803566-50803588 AAGCACAAGGTTTTTGAATATGG + Exonic
1167682808 19:50935470-50935492 AAAATCAGTGTTTTTAAAAAAGG - Intergenic
926988860 2:18654839-18654861 AAGTTCATTTTTTTTGAATCAGG - Intergenic
928534274 2:32224930-32224952 TAGGGCAGTGATTGTGAATATGG + Intronic
929776379 2:44933446-44933468 AAGGTCAGTTTGTTTGAAAAGGG + Intergenic
930009682 2:46926575-46926597 AAGCCCAGATTTTTTGAATAAGG + Intronic
930321381 2:49858592-49858614 AAGGTTGGTGTCTTTAAATAGGG + Intergenic
930642457 2:53867616-53867638 GAGTGCAGTGGTTTTGAATATGG - Intronic
933443721 2:82349930-82349952 AAGGCCAGAGTTTATGATTATGG + Intergenic
935030737 2:99318947-99318969 AAAGTCAATCTTTTAGAATAGGG - Intronic
936158433 2:110065176-110065198 AAGTTCAATATTTTTGAATGTGG + Intergenic
937191480 2:120104541-120104563 AAGGTTTGTGTTTGTGAACAAGG + Intronic
938131691 2:128721345-128721367 AAGGTTAGGGTTTTGGCATATGG + Intergenic
939205641 2:139099154-139099176 ATACTCAGTGTATTTGAATATGG + Intergenic
944896894 2:204174381-204174403 AATGCCAGTGTTTTCAAATATGG + Intergenic
945809690 2:214533705-214533727 AATGTCTGTGTTTATGACTAGGG - Intronic
946637750 2:221748496-221748518 TAGGTCAATATTTTAGAATAGGG + Intergenic
946692892 2:222322133-222322155 AAGGTCTGTATGTTTGAATATGG + Intergenic
946818588 2:223607169-223607191 AAAGTCAGTGCATTTGCATAAGG - Intergenic
947046468 2:225992683-225992705 AAGCTCAGTGATTTTGAACACGG - Intergenic
947173385 2:227335582-227335604 TAGGTCAGTGGTTTTCAGTAGGG - Intronic
947342507 2:229154760-229154782 AAGGAAAGTGCTTTTGTATATGG - Intronic
1169056552 20:2626686-2626708 AAGGTCAGTGTCTTGGAAATAGG - Intronic
1169563839 20:6830806-6830828 CAGGTAAGTGCTTTTGAATGTGG - Intergenic
1170349941 20:15427834-15427856 AAGGTCAGTGATTCTCAACAAGG + Intronic
1171287206 20:23951100-23951122 AATGAAAGTGTTTTTGAAAAGGG - Intergenic
1173878545 20:46392967-46392989 AAAGTCAGTCTTTTTGTATCAGG - Intronic
1173980149 20:47217835-47217857 AGGGGCAGTTTTTCTGAATAAGG - Intronic
1176361856 21:6003762-6003784 AAGTTCTTTGTTTTTGCATATGG + Intergenic
1177121213 21:17139198-17139220 AAGTTCAGTGTTTCTGAAAATGG + Intergenic
1177531372 21:22362119-22362141 AAGGTCACAGTTTTTGACTATGG - Intergenic
1177667229 21:24176266-24176288 AAGGTCTATCTTTTTGAATATGG + Intergenic
1178064345 21:28887460-28887482 ACGGTCAGATTTTGTGAATATGG - Intergenic
1179535841 21:42051345-42051367 AAGGGCATTCTATTTGAATAAGG - Intergenic
1179761662 21:43534783-43534805 AAGTTCTTTGTTTTTGCATATGG - Intronic
1184972373 22:48035012-48035034 AAGGTCAAATTTTATGAATAAGG - Intergenic
949127147 3:459757-459779 AAGGTTAGTATTTTAGATTAGGG + Intergenic
949235034 3:1798599-1798621 AATGTCAATGTTTATGATTACGG + Intergenic
949439027 3:4060559-4060581 AATGTTAATGTGTTTGAATATGG - Intronic
950462192 3:13131401-13131423 AAGGTCACTGCCTTTTAATAGGG + Intergenic
951102024 3:18699524-18699546 AAGGTCAGTCTTTTTTCTTAAGG - Intergenic
951658608 3:25037075-25037097 AATGTCAGTTTTGTTGAATTTGG - Intergenic
952453083 3:33449493-33449515 AACCTCAGTGTTTTATAATAGGG + Intergenic
952701736 3:36335855-36335877 AATTTCAGTGTTTTTTGATAGGG + Intergenic
955170494 3:56559851-56559873 AAAATCAGTATTATTGAATATGG + Intronic
956507207 3:69954718-69954740 ATGGTCAATGGTTTTGAAGAAGG - Intronic
956560495 3:70569455-70569477 AAGGTAAGTGTTGCTGAATTAGG - Intergenic
956871866 3:73426251-73426273 AAGGACAGTGTTTCTGACTATGG - Intronic
958616875 3:96504947-96504969 GAGGACTGTGATTTTGAATATGG + Intergenic
959515600 3:107263442-107263464 GAGGTCAGGGTCTGTGAATAAGG + Intergenic
962679045 3:137780087-137780109 AAGGCCAGTGTTTCTGAAACTGG - Intergenic
963077539 3:141361216-141361238 AAAGTCAGTGTTTTTAGATATGG + Intronic
963714908 3:148791835-148791857 ATGCTCTGTGTTTTGGAATAAGG + Intronic
963886211 3:150585777-150585799 AAGGTAAGTGTGTTTGAATGAGG + Intronic
965188825 3:165502785-165502807 AATGTCAGTGTTTGAGAACAAGG - Intergenic
966524845 3:180909673-180909695 AATGTGAGTGATTTTGAGTATGG - Intronic
970284719 4:14497952-14497974 ATTGTCAGTGTTTTTGAAAGTGG - Intergenic
970409933 4:15795117-15795139 AAAGACAGTTTTCTTGAATAAGG + Intronic
971734513 4:30429070-30429092 AAGATAAGTGTTTTAGAATTTGG - Intergenic
972211779 4:36847230-36847252 AATGTCAGAGATTCTGAATAAGG - Intergenic
972721852 4:41707834-41707856 AAAGTAAATGTTTTTGAAAATGG - Intergenic
975169859 4:71221312-71221334 AAGGACAGTGTTTTTAAATTGGG + Intronic
975344198 4:73275389-73275411 AAGTCCAGTGTTTTTTATTAAGG - Intergenic
975884895 4:78953308-78953330 AAGTTTAGTGCTTTTTAATAAGG + Intergenic
976148475 4:82067676-82067698 AAGGTAATGGTATTTGAATATGG - Intergenic
976768570 4:88624898-88624920 AAGGTTCGTTTTTTTGCATATGG + Intronic
976779459 4:88742408-88742430 AAATCCAGTGTTTTTGACTATGG + Intronic
977269638 4:94900540-94900562 AAGGGCAGAGTTTCAGAATAAGG + Intronic
979468074 4:121063776-121063798 AAGGTTAGTCTTTTTTAACAGGG - Intronic
979538201 4:121849100-121849122 AACTTCAGTGTTTTTAAATTTGG + Intronic
980389693 4:132126998-132127020 AGAGCCAGTGTTTATGAATAGGG - Intergenic
982637226 4:157912391-157912413 AATGTCAGCGTTTTTGAAAGAGG - Intergenic
984304173 4:177965644-177965666 AAGTTAAGTGTTTTTGAGTCTGG + Intronic
984441782 4:179780006-179780028 AACGTAAGAGTTTTTGACTAGGG + Intergenic
987416649 5:17669470-17669492 TAGGTCAGTGTTCTAGAACATGG - Intergenic
987895351 5:23938834-23938856 AATGTCATTGTATTTTAATAGGG + Intergenic
988915422 5:35889151-35889173 AAGGTGAGTGTATTTGACAATGG - Intergenic
991198741 5:63964085-63964107 CAGGACAGTGTGTTTGGATAAGG + Intergenic
991606356 5:68405457-68405479 AGGGTGGGTGTTTTTGAATGAGG - Intergenic
993261623 5:85663900-85663922 AAGGTAAGTGTTTTTGTTGAAGG + Intergenic
994899365 5:105750393-105750415 TATGTCAGTGCTGTTGAATATGG - Intergenic
995690512 5:114820748-114820770 AAGTTCAATATTTTTGCATATGG - Intergenic
997011940 5:129888899-129888921 TAGGTCAGTGTTTTTCAAAGTGG - Intergenic
997802202 5:136874980-136875002 AAAGTCAGTGTTTTTACATAGGG + Intergenic
998354273 5:141521605-141521627 AAAGCTAGTGTCTTTGAATAGGG + Intronic
998562435 5:143183997-143184019 AGGGTCAGAGTTTCTGAACAGGG - Intronic
998981522 5:147708434-147708456 TAAGTCAGTGTTTTGGAATGTGG - Intronic
1000153328 5:158525193-158525215 AATTTCAGTGTCTTTGCATAGGG - Intergenic
1000732536 5:164854161-164854183 AATTTCAGTGTTTTATAATAAGG + Intergenic
1003430932 6:6036712-6036734 AAGGTCTGTGTGGTAGAATAGGG + Intergenic
1003752184 6:9071247-9071269 AAGGTCATTGTGTTTCAGTATGG + Intergenic
1004738680 6:18434374-18434396 AAGGTCAGTGTTAGTGTAGATGG + Intronic
1005141302 6:22634613-22634635 AAGGTGAATGTTTTTGACTTAGG - Intergenic
1005406887 6:25498915-25498937 AAGGACACTGTTTTAGAATAAGG + Intronic
1006505831 6:34488076-34488098 AAGGTCAGGGTCATTGAAGAGGG - Intronic
1006624891 6:35390341-35390363 TAGGTCAGTGCTTTTGTACATGG + Intronic
1007459435 6:42007251-42007273 AAGGTCTGTGTTTTTGAAAATGG + Intronic
1010086914 6:71931083-71931105 AGGGTCAATGTATTTGAATTCGG - Intronic
1010168970 6:72952134-72952156 AAGATTAGTATTTTTGGATAAGG + Intronic
1010479495 6:76333554-76333576 AAGGTGAGTTTTTTTGTATAAGG + Intergenic
1010900090 6:81416609-81416631 ATGGTCATTTATTTTGAATAAGG + Intergenic
1011929923 6:92699205-92699227 AGTGTCAATGTTTTTAAATAGGG + Intergenic
1012162546 6:95904342-95904364 GAGGTCAGTGTCTTTGCTTACGG + Intergenic
1012526377 6:100182722-100182744 GAGATCAGTGATTTTCAATATGG - Intergenic
1012562524 6:100600879-100600901 ATGGTGAGTGTCTTTAAATATGG - Intronic
1013888711 6:115000833-115000855 AACTTCAGTGTTTTATAATAGGG + Intergenic
1014638009 6:123872826-123872848 AAGGTAAGTGTGATTGATTATGG + Intronic
1014889401 6:126824282-126824304 AAGGTCAGTCTTTAGGATTATGG - Intergenic
1016052229 6:139541984-139542006 ATGGTCAGTGTTTTCCAACAGGG + Intergenic
1016563296 6:145422581-145422603 GAGGTCAGTTTTTTTGAGAAAGG - Intergenic
1016769181 6:147829380-147829402 AAGTTCATTGTTTGTGAATTAGG - Intergenic
1016960867 6:149671436-149671458 ATGTTCAGTTTTTTTGTATACGG + Intronic
1017161786 6:151372264-151372286 AAGGGCAGTGGTTTTGATGAGGG + Intronic
1018999112 6:168732718-168732740 CAGGTCAGTGAATTTGAATGTGG + Intergenic
1021265966 7:18523075-18523097 GAGTTCAGTGTTTTTGAAGATGG + Intronic
1021487697 7:21184909-21184931 AAGGTAAGTGTTTTTAAACTTGG + Intergenic
1021905480 7:25329008-25329030 AAGGTCATAGTTGCTGAATAAGG - Intergenic
1022169191 7:27807047-27807069 CTGGTTATTGTTTTTGAATATGG + Intronic
1022432290 7:30337384-30337406 AAGTTCTGTGATTTTGATTAAGG - Intronic
1023588913 7:41760149-41760171 AAGGTCAGTGTTCTGGGAAAGGG - Intergenic
1027920016 7:84381128-84381150 AAGGGCAATGTTTTAAAATATGG - Intronic
1028163566 7:87512501-87512523 CAGGTCAATGTTTTTCAACATGG + Intronic
1028866557 7:95720301-95720323 AAGGTCACTGTGGTTGGATATGG + Intergenic
1030248515 7:107413368-107413390 AAGGTGAGTGATTGTAAATATGG - Intronic
1030671175 7:112338602-112338624 AAGAACAGTATTTCTGAATAAGG - Intronic
1031446858 7:121865209-121865231 AAGGTGAATGGTTTTTAATATGG + Intergenic
1031654055 7:124329674-124329696 AAGGCCAGTGTTTTTTAGTATGG - Intergenic
1032555339 7:132827259-132827281 AATGGAAGTGTTTTTGAATTTGG + Intronic
1033004099 7:137541700-137541722 GAGGTTAATGTTTTTGCATATGG - Intronic
1033709754 7:143930275-143930297 AAGTTCAGACTTTTTGAAAAAGG - Intergenic
1033861335 7:145631608-145631630 AAAGTGATGGTTTTTGAATAGGG + Intergenic
1033980525 7:147159036-147159058 AAGGTCAGGGTTCTTGATTTGGG + Intronic
1034168967 7:149048007-149048029 TAGGTCAGTGATATTCAATAAGG + Intergenic
1035877053 8:3202334-3202356 TAAGTCAGTGTGTATGAATACGG - Intronic
1037227646 8:16612419-16612441 CAGGATAGTGTCTTTGAATAAGG - Intergenic
1037329620 8:17731555-17731577 TAGGTCAGTCTTCTTGAGTAGGG + Intronic
1039129333 8:34244798-34244820 TAGGACAGTGTTTTTCAATAGGG - Intergenic
1041778660 8:61553681-61553703 TAGGTAAATGTTTTAGAATAGGG - Intronic
1042893424 8:73638406-73638428 AAAATAAGTGTTTTTTAATATGG - Intronic
1043022232 8:75017986-75018008 ATGTACAGTGTTTTCGAATAAGG - Intronic
1044358606 8:91255820-91255842 AAGGTCATGGTTCTTCAATATGG - Intronic
1044478003 8:92651119-92651141 AGGGTCAGTGGGCTTGAATATGG - Intergenic
1044493448 8:92847899-92847921 AAGGTCTATATTTTTGCATAGGG + Intergenic
1044877968 8:96691391-96691413 AAAGTCCCTTTTTTTGAATAAGG + Intronic
1044897038 8:96903442-96903464 AAGGTGAGTATTTATGAAGAAGG + Intronic
1045188767 8:99863381-99863403 AAGGTCATTGTTTTGCAATTCGG + Intronic
1045815738 8:106273721-106273743 AAAACAAGTGTTTTTGAATATGG - Intronic
1045997698 8:108382733-108382755 AAATTCATTGGTTTTGAATAAGG + Intronic
1047405520 8:124582509-124582531 AAGATCAGAGTTTTTGAAAAAGG + Intronic
1048077509 8:131088574-131088596 TAGGTCAGTGTTTCTCAATTGGG + Intergenic
1048165874 8:132061013-132061035 AAGGCCAGTGGTTTTCAATCAGG - Intronic
1051397575 9:16642091-16642113 CAGGTGAGTGTTTTAGAAGAAGG - Intronic
1051526029 9:18045591-18045613 AAGGGCAGTGCTTTTGTATTTGG - Intergenic
1052638818 9:31137558-31137580 AAGGTCAGTGCTATAGAAAATGG - Intergenic
1054192979 9:62001442-62001464 AACGTCAGTGTTCTCAAATATGG + Intergenic
1054983212 9:71231368-71231390 TACATCACTGTTTTTGAATATGG + Intronic
1055007274 9:71522629-71522651 AGGGCCATTGTTTTAGAATATGG + Intergenic
1056218790 9:84430668-84430690 ATAGTCAGTGGTTTTGAATGTGG - Intergenic
1056276831 9:85001871-85001893 AAGGCCAGAATTTCTGAATAGGG + Intronic
1057029946 9:91767987-91768009 AAGGACAGTGTTGTTGGATTAGG - Intronic
1059377518 9:113897110-113897132 GAGATCTGTGTTTTTTAATATGG + Intronic
1059738257 9:117123797-117123819 AAGGTCAGTTTGTTTAAATTCGG + Intronic
1186198047 X:7129729-7129751 AAGGTCAGTGTTTTTGAATAAGG - Intronic
1186305316 X:8250402-8250424 AATGTCAGTGATCTTGAACAAGG - Intergenic
1186944121 X:14546062-14546084 AAGGTCACAGTTTGTTAATAAGG + Intronic
1188913987 X:35887615-35887637 CAGGTCAGTGTTTTTCATCATGG + Intergenic
1188991546 X:36826906-36826928 GTGGTCAGTGTTTTTGAAAAAGG + Intergenic
1189096924 X:38150376-38150398 AAAGTCAGTGATTATGAACAGGG + Intronic
1190123340 X:47682071-47682093 AAGGTCACTGTTCTTCTATAAGG + Intergenic
1190624595 X:52324744-52324766 AATGTCATTGTGTCTGAATATGG - Intergenic
1190749696 X:53351014-53351036 TAGATGAGTGTTTTTGCATATGG - Intergenic
1193634652 X:83933771-83933793 AAAGAAATTGTTTTTGAATAAGG + Intergenic
1193834709 X:86327473-86327495 TAAATCAATGTTTTTGAATAAGG + Intronic
1194905038 X:99565280-99565302 AAGGTTAGTGTTGTAGAACAAGG + Intergenic
1194969347 X:100325806-100325828 AAGCACTGTGTTTTTGAAAAAGG - Intronic
1195513740 X:105747378-105747400 AATGTCACTCTTTTTGAGTATGG - Intronic
1196713023 X:118783032-118783054 AAGGCCAGTGTTTTTGCATGGGG + Intronic
1196991917 X:121339114-121339136 AAGGTCAGTGTAATGAAATATGG + Intergenic
1197280599 X:124531091-124531113 AAGGTCAGTGATTTTTCCTAGGG + Intronic
1197304799 X:124828770-124828792 GAAGTCAGTGTTGTTAAATAAGG - Intronic
1197485645 X:127047388-127047410 AAGTTCTGTGTTATTGGATAGGG - Intergenic
1199311303 X:146323845-146323867 AAGCTCAATATTTTTGAATATGG - Intergenic
1200823776 Y:7618085-7618107 AAGGTCAGTGTTCAAGAATGTGG - Intergenic
1201571651 Y:15421796-15421818 AAGGTCAGTGTTTTTGAATAAGG - Intergenic
1201578796 Y:15489914-15489936 AAGGTAAGTGTTTTTCATTGGGG - Intergenic
1201908198 Y:19106358-19106380 AAGCTCAGTGTTCTATAATAGGG - Intergenic
1202236280 Y:22713003-22713025 AAGGTCAGTGTTCAAGAATGTGG + Intergenic
1202306885 Y:23483165-23483187 AAGGTCAGTGTTCAAGAATGTGG - Intergenic
1202563922 Y:26187421-26187443 AAGGTCAGTGTTCAAGAATGTGG + Intergenic