ID: 1201571652

View in Genome Browser
Species Human (GRCh38)
Location Y:15421815-15421837
Sequence CCAGATGTGAGATCTTTAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 2, 1: 0, 2: 0, 3: 21, 4: 244}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201571652_1201571658 8 Left 1201571652 Y:15421815-15421837 CCTTTTAAAGATCTCACATCTGG 0: 2
1: 0
2: 0
3: 21
4: 244
Right 1201571658 Y:15421846-15421868 ACTTCTGTGAAGGCAAAGGAAGG No data
1201571652_1201571655 -2 Left 1201571652 Y:15421815-15421837 CCTTTTAAAGATCTCACATCTGG 0: 2
1: 0
2: 0
3: 21
4: 244
Right 1201571655 Y:15421836-15421858 GGGCCACAGAACTTCTGTGAAGG No data
1201571652_1201571657 4 Left 1201571652 Y:15421815-15421837 CCTTTTAAAGATCTCACATCTGG 0: 2
1: 0
2: 0
3: 21
4: 244
Right 1201571657 Y:15421842-15421864 CAGAACTTCTGTGAAGGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201571652 Original CRISPR CCAGATGTGAGATCTTTAAA AGG (reversed) Intergenic
900574065 1:3374341-3374363 ACAGATGTGTCATTTTTAAAGGG - Intronic
900674177 1:3873777-3873799 CCAGATGTGGGATTTTTTTAAGG + Intronic
900719461 1:4165941-4165963 CCAGATGTGAAGTCTTTTGATGG + Intergenic
901058548 1:6460907-6460929 CCAGATGAGAGCGCTTTAATGGG - Exonic
901694522 1:10996939-10996961 CCAGTTTTTACATCTTTAAATGG - Intergenic
902108961 1:14061794-14061816 ACAGATGTGATATATCTAAAAGG - Intergenic
904693571 1:32313481-32313503 CCAGGGCTTAGATCTTTAAAAGG + Intronic
904758512 1:32783614-32783636 CCAGATTTGAGATATAAAAAAGG - Intronic
908192605 1:61718676-61718698 CCAGATGTGAGATGTTGGGAAGG + Intronic
908942803 1:69455731-69455753 ACAGATGTCAGACCTTTAAGAGG + Intergenic
909447923 1:75768206-75768228 CCAGCTCTGACATTTTTAAATGG - Intronic
910544544 1:88398893-88398915 TAAGAAGTGAGATCTTTAAGAGG + Intergenic
911123212 1:94316370-94316392 CCAGATGTGTAATTTTTAACAGG - Intergenic
911250606 1:95572337-95572359 CCAGATATAATATATTTAAACGG - Intergenic
911862414 1:102969517-102969539 CCAGATGTCTGATTTTGAAAGGG + Intronic
912245125 1:107953866-107953888 TCACATGAGAGTTCTTTAAAGGG - Intronic
913508158 1:119538269-119538291 CCATTTGTTAGATCGTTAAAAGG - Intergenic
914439744 1:147694058-147694080 TGAGAGGTGAGATCTTTAAGAGG - Intergenic
916386735 1:164281605-164281627 TCAGAGGTGGGATCTTTAAGAGG + Intergenic
920790346 1:209084072-209084094 CAGGAGGTGAGATTTTTAAAAGG - Intergenic
922297673 1:224265668-224265690 TGAGATGTGGGACCTTTAAAAGG + Intronic
923259021 1:232248975-232248997 CCAAATATGAAATATTTAAATGG + Intergenic
923316918 1:232789365-232789387 CAAGAGGTGAGGTCTTTAAGAGG - Intergenic
923958745 1:239053095-239053117 CCAAATGTAAGATAATTAAAAGG + Intergenic
924170777 1:241338042-241338064 CAGAATGTGAGATTTTTAAAAGG + Intronic
924814092 1:247427424-247427446 ACAGATGTGTGATCTTCATAAGG - Intronic
1063306339 10:4904720-4904742 CCATATGTGAGAAATTCAAAGGG - Intergenic
1066986617 10:42474380-42474402 ACAGAACTGAGATATTTAAAAGG + Intergenic
1068369909 10:56099455-56099477 CCAGATGGGAGATAATTAAGGGG - Intergenic
1068742683 10:60492328-60492350 AGAGTTGTGAGGTCTTTAAAAGG + Intronic
1069664409 10:70145369-70145391 CCAGATCTGAGACCTGGAAAGGG + Intronic
1071235335 10:83639944-83639966 TGAGGTGGGAGATCTTTAAATGG - Intergenic
1071370133 10:84942818-84942840 CCAGATGTGAAAACTTGAATGGG - Intergenic
1073469258 10:103712663-103712685 CCACATTTGGGATCTTTTAAGGG - Intronic
1074130796 10:110572519-110572541 CCAGATGTGATATCCTGAGAGGG - Intronic
1075820995 10:125310841-125310863 CCAAATGTTCGTTCTTTAAAAGG + Intergenic
1077912785 11:6587485-6587507 CCAGATCTGGGCTCTTTGAAGGG - Intronic
1078401079 11:11027914-11027936 ACAGATGTGACAGCATTAAAGGG + Intergenic
1078972657 11:16431933-16431955 TAAGATGTGAGATCATAAAAAGG + Intronic
1080038608 11:27735455-27735477 CCACATGGGAAATCTTTCAAGGG - Intergenic
1081100325 11:38993748-38993770 CCAAATGTGATATCTTTTGAGGG + Intergenic
1082687522 11:56259203-56259225 CAAGAAGTGAGACCTTTAAGAGG - Intergenic
1083821220 11:65172472-65172494 CCAAATGTGAGATTTTTCCATGG + Exonic
1084063266 11:66689214-66689236 CAGGATGTGAGATCTTTCCACGG + Intronic
1084674701 11:70627320-70627342 CCAGATGTGGCAACTATAAATGG + Intronic
1085285821 11:75359915-75359937 CCAGAAGTTAGATCTTTAGAAGG + Intergenic
1085370695 11:76002037-76002059 CCAGATGTGATACCCTTAGAAGG + Intronic
1085554102 11:77403857-77403879 TGAGAGGTGAGATCTTTAAAAGG + Intronic
1086574784 11:88327340-88327362 CCAGAAGTGAGATATGAAAAAGG - Intronic
1086719429 11:90101760-90101782 CCACATGTCAAATATTTAAAAGG - Intergenic
1091359197 11:134961582-134961604 CCAGATGTGAGCTCTGTGGATGG - Intergenic
1091359216 11:134961712-134961734 CCAGATGTGAGCTCTGTGGACGG - Intergenic
1091841642 12:3625616-3625638 CTAGATGGGAGATTTTCAAAGGG + Intronic
1092607977 12:10140848-10140870 CCAGCTGTGTAATTTTTAAAAGG - Intergenic
1092748405 12:11695132-11695154 CCAGATTTGGTATCATTAAAAGG - Intronic
1093278361 12:17157581-17157603 TGAGGTGTGAGATCTTTGAATGG - Intergenic
1094033949 12:26047037-26047059 CCAGTTCTGAGAGCTTTAACGGG + Intronic
1094096922 12:26716328-26716350 CCAGATGTCAGATCAATAATGGG - Intronic
1094160010 12:27380383-27380405 CAACACTTGAGATCTTTAAAAGG + Exonic
1095721714 12:45408259-45408281 CCAGATGTTAGATCTGTATTTGG + Intronic
1097548101 12:61030304-61030326 TGAGAGGTGAGATCTTTAAAGGG + Intergenic
1098837831 12:75442790-75442812 TCCGATTTTAGATCTTTAAAGGG + Intergenic
1098886515 12:75966166-75966188 CCAGTGGTGACTTCTTTAAAAGG - Intergenic
1099544264 12:83956651-83956673 CAAGATCTGAGAGTTTTAAAAGG - Intergenic
1099705904 12:86152488-86152510 TAAGATGTGAGATCTTTAGAAGG - Intronic
1099765880 12:86982929-86982951 CCAGATTTCTGCTCTTTAAAAGG - Intergenic
1100056165 12:90513055-90513077 CTAGATGTGAGTTCATTACAAGG - Intergenic
1100331024 12:93582339-93582361 GCAGATGTCAGCTTTTTAAATGG + Intronic
1100508724 12:95246421-95246443 CCAGATCTGATATCTTTATGTGG + Intronic
1100977132 12:100134301-100134323 CCAAATGTTAGATATTTAATTGG - Intronic
1101516037 12:105436183-105436205 TCAGAGGTGGGATCTTTAAGAGG + Intergenic
1101618566 12:106361617-106361639 CCAAATGTGGGCTCTTTCAAGGG - Intronic
1102393816 12:112571072-112571094 CCATATATCATATCTTTAAAAGG + Intronic
1106122871 13:26876123-26876145 CCAGATATGAGATGATTGAATGG - Intergenic
1107989755 13:45809227-45809249 GCAGAACTGAGACCTTTAAATGG + Intronic
1108378929 13:49838719-49838741 CCAGATTTGGAATCTTTAAAGGG - Intergenic
1109332419 13:60945847-60945869 CCAGTTGGGAGGTCTTTTAATGG + Intergenic
1110645468 13:77878424-77878446 CCAGATATGAAATCTACAAAAGG - Intergenic
1111149042 13:84223922-84223944 CCAGATATGATAACTTTAGAGGG + Intergenic
1112354336 13:98661463-98661485 CCAGAGGTGAGACCATTAGATGG - Intergenic
1112399198 13:99061078-99061100 AAAGATGAGAGATCCTTAAAAGG - Intronic
1112720491 13:102238480-102238502 TGAGATGTGAGATATATAAATGG - Intronic
1113066857 13:106381551-106381573 CCAGAGGTAAGCTCTTTAAGTGG + Intergenic
1116457393 14:45134925-45134947 TCGGTTGTGTGATCTTTAAAAGG - Intronic
1119455219 14:74749354-74749376 CAAGAGGTGAGATCTTTAAGAGG - Intergenic
1119604350 14:76001944-76001966 CAAGATGTGGGATTTTTAAGAGG - Intronic
1120720656 14:87886920-87886942 CTAGATATGAGATATCTAAATGG + Intronic
1121699180 14:95939214-95939236 TCAGATGTGACATCTTTCTAGGG - Intergenic
1125025104 15:35021819-35021841 AGAGATGTGTCATCTTTAAAGGG + Intergenic
1125133345 15:36310816-36310838 CCAGAGGGGAGGTCTTAAAAAGG - Intergenic
1125283705 15:38070720-38070742 TCACATGTGAGATTTTTAAGTGG + Intergenic
1127331603 15:57945207-57945229 TGAGAAGTGAGATCTTTAAGAGG + Intergenic
1128309890 15:66623457-66623479 CCATATGTGTGATCTTGACAAGG + Intronic
1130413000 15:83662933-83662955 GCAGATGTGAGTTCTTTGGAGGG + Intronic
1131457005 15:92589434-92589456 ACAGATGTGGGATCTTGAAGCGG - Intergenic
1131843246 15:96460950-96460972 TAAGAGGTGGGATCTTTAAAAGG - Intergenic
1132712934 16:1277273-1277295 CCAGATCTGAGATTTTTCCAAGG - Intergenic
1133419289 16:5631995-5632017 CCTCCTGTGAGATCTTTAGACGG - Intergenic
1134311086 16:13075766-13075788 CCAGCTGTGTGATCTTTATCAGG - Intronic
1135844282 16:25904460-25904482 CCAGAGGTGAGATTATTAAATGG + Intronic
1136611054 16:31365439-31365461 CCAGCTGTGTGATCTTTGACAGG + Intronic
1138623512 16:58230759-58230781 CCAGATTTGAGTTCCATAAATGG + Intergenic
1140310769 16:73846368-73846390 CTAGAAATGAGATCTTTAATTGG - Intergenic
1146374133 17:32283113-32283135 GCAGCTGTGAGTTGTTTAAAAGG - Intronic
1147035642 17:37678061-37678083 CTAGCTGTGAGATCTTTGGAAGG - Intergenic
1149977479 17:61280518-61280540 CAAGATGTGAAATCTTTAAGTGG - Intronic
1150075821 17:62191288-62191310 CCAGAAGAGAGATTTTTTAAAGG - Intergenic
1150789582 17:68191653-68191675 CAAGATGAGTGATGTTTAAAAGG + Intergenic
1152388376 17:79988699-79988721 CCAGATGTTGGCTCTTTAATTGG + Intronic
1153197151 18:2613076-2613098 CCACATGTGAGACCTTTATGGGG - Intronic
1154071187 18:11152890-11152912 CCATCTCTGAGATCTTTCAAAGG - Intergenic
1155347771 18:24875622-24875644 CCAGATGTTTGATCTTAAATAGG + Intergenic
1155549906 18:26953918-26953940 CCACATGTGAAGTCTTGAAATGG + Intronic
1156613587 18:38756265-38756287 ACAAATGTAAGATCATTAAAGGG + Intergenic
1156901107 18:42301125-42301147 CCAGATTTGAGCTCTTACAATGG - Intergenic
1159747684 18:72258754-72258776 CCAAATGTGTGATCTAAAAAGGG + Intergenic
1163842524 19:19619971-19619993 CCAGATGTGGGCTCAGTAAAAGG + Intergenic
1167235853 19:48314584-48314606 AAAGATGTGACATCTTCAAAAGG - Intronic
925516449 2:4688997-4689019 TAAGAGGTGAGATCTTTAAGAGG - Intergenic
926426707 2:12744823-12744845 CCAAATGTGATAGCATTAAAAGG + Intergenic
926526674 2:13990294-13990316 CCAGGTGTGAGAACATTCAAAGG + Intergenic
929408041 2:41665704-41665726 CAAGAGGTGGGATCTTTAAGAGG - Intergenic
929643918 2:43608727-43608749 CCAAAGGTGATTTCTTTAAAGGG + Intergenic
930382287 2:50646541-50646563 GCAGATCTGAGATCTTTCTATGG + Intronic
930979183 2:57501246-57501268 CCACATGGGACATTTTTAAAAGG - Intergenic
932537155 2:72610939-72610961 CCTGATGTGATATGATTAAAAGG + Intronic
932800713 2:74740279-74740301 CCAGTTGTGAGACTTTTAAGTGG + Intergenic
933133676 2:78703816-78703838 TGAGAGGTGAGATCTTTAAAGGG + Intergenic
935057479 2:99580220-99580242 CCTGATGCGAGATCTCTAAAAGG - Intronic
937578170 2:123450194-123450216 CCAGATATGAGTATTTTAAAAGG + Intergenic
940949444 2:159655933-159655955 CCAGATGTTAGATTTTGCAAAGG - Intergenic
941354954 2:164479295-164479317 AAAGAAGTGAGATATTTAAAGGG - Intergenic
943934498 2:193898284-193898306 TAAGAGGTGAGATCTTTAAAAGG + Intergenic
944115121 2:196177669-196177691 CCAGCTGTGAGATCTTGACCAGG + Intergenic
944868689 2:203887930-203887952 ACAGATGTAAGTTGTTTAAAAGG + Intergenic
947378350 2:229520688-229520710 CCAGATGTGGGATGCTCAAATGG - Intronic
1169304782 20:4479868-4479890 CCAGATGTGACAACTCTCAAAGG + Intergenic
1173356864 20:42301401-42301423 ACAGATATGAGAACTCTAAAGGG + Intronic
1173434620 20:43021562-43021584 CCAGATGTGAGATGGCTGAATGG + Intronic
1174177930 20:48656784-48656806 CTAGATCTGAGATCTATGAATGG + Intronic
1175541314 20:59749847-59749869 CTGGATTTGACATCTTTAAATGG - Intronic
1175581006 20:60099693-60099715 CCAGATGTTTAATTTTTAAATGG + Intergenic
1181777605 22:25170784-25170806 CCAGATGTGAGATTTCTACCAGG - Intronic
1182807885 22:33090957-33090979 ACAGATGTCAGCTCTATAAAAGG - Intergenic
1183877198 22:40793494-40793516 CAAGATGTGATATCTTGAGAAGG + Intronic
1184594745 22:45507001-45507023 CCACATGTGAGATCATCACAAGG - Intronic
949322615 3:2827922-2827944 CAAAATGTGAGATTTTTAAATGG + Intronic
949330822 3:2920025-2920047 AAAGATGAGAGATCTTGAAATGG + Intronic
949677191 3:6469186-6469208 TAAGAGGTGAGACCTTTAAAAGG + Intergenic
949759989 3:7459604-7459626 CCAGATCTGATGTCTTTAAAAGG - Intronic
951419943 3:22472220-22472242 TCAGAGGTGGGATCTTTAAGAGG - Intergenic
951531014 3:23698148-23698170 TCAGAGCTGAGGTCTTTAAAAGG + Intergenic
951939955 3:28066559-28066581 TCAGATGTGAGGACTTTCAAAGG + Intergenic
952466754 3:33597200-33597222 CCAGATGTGAAATTTTAAAGGGG - Intronic
953154508 3:40356916-40356938 CCAGATCTGAGCTCTTCTAAAGG + Intergenic
953533315 3:43757324-43757346 CCTGAGGGGAAATCTTTAAATGG - Intergenic
953759210 3:45673610-45673632 CCAGAGTTGAGATTTTTAAAAGG - Intronic
954942152 3:54383422-54383444 CCAGAAGGGAGCTCTTTGAATGG - Intronic
955548606 3:60058602-60058624 GCAGATGTGGCATCTTTCAAAGG - Intronic
957285631 3:78214038-78214060 TGAGATTTGAGATTTTTAAAAGG - Intergenic
957395454 3:79630919-79630941 CCAGATGAGAGATCTCTGCAAGG + Intronic
957528763 3:81413193-81413215 CCAGCTGTCACATTTTTAAATGG + Intergenic
957716947 3:83940046-83940068 CCAGATGTGTTATGTTTAAAAGG - Intergenic
959088597 3:101878044-101878066 CCAGATGTTATATCTATAGAAGG + Intergenic
959143744 3:102518705-102518727 GCAGATGAGAGATCTTGAAGAGG - Intergenic
959360042 3:105376980-105377002 CCAGTTGTGGGATCTACAAAAGG + Intronic
959873358 3:111353384-111353406 TTGGAGGTGAGATCTTTAAATGG + Intronic
961565316 3:127759520-127759542 CCACAGCTGAGATTTTTAAATGG - Intronic
963423096 3:145087330-145087352 TTAGAGGTGAGACCTTTAAAAGG - Intergenic
963496093 3:146063256-146063278 CCCAATCTGAGATATTTAAAAGG - Intergenic
964951191 3:162295639-162295661 GCAGAAGTGAGAGGTTTAAAAGG - Intergenic
966513527 3:180791202-180791224 CCAGATGTGATATTTTGAGAAGG + Intronic
967687828 3:192438170-192438192 GCACATGTGAGATTTTTTAAAGG - Intronic
967689926 3:192462280-192462302 TGAGAGGTGAGGTCTTTAAATGG + Intronic
969216181 4:5724138-5724160 ACAGATGTGTGATAATTAAATGG + Intronic
969966878 4:11005573-11005595 ACAGATGTGACACCTGTAAAAGG - Intergenic
970941097 4:21634843-21634865 TAAAATGTGAGTTCTTTAAAGGG - Intronic
971236763 4:24849379-24849401 CCAGATGAGAGATGTGAAAAGGG - Intronic
972732429 4:41808133-41808155 CATGAGGTGAGATCTTTAAATGG - Intergenic
973897518 4:55429570-55429592 CCAAATTTAAGAACTTTAAATGG + Exonic
974329516 4:60459441-60459463 ACAGATGTTAGATGTTAAAAGGG + Intergenic
974671196 4:65032465-65032487 TAAGAGGTGAGATCTTTAAGAGG + Intergenic
976067246 4:81202134-81202156 CCAGAAGTTAGAGCATTAAAAGG - Intronic
976834845 4:89360138-89360160 CCAGATGTGCTCTCTTTAAATGG + Intergenic
977533964 4:98234808-98234830 CTAGATGAGAGAGCTGTAAATGG + Intergenic
978463279 4:108981669-108981691 TCACCTGTGTGATCTTTAAATGG + Intronic
979636311 4:122958335-122958357 CCAGTTGTGCTATGTTTAAATGG + Intronic
980038241 4:127909421-127909443 CCATCTCTGAGATCTTTCAAAGG + Intergenic
980560886 4:134473627-134473649 CTATATGTGAGATCTTAAAAAGG - Intergenic
982807380 4:159783228-159783250 ACAGATGTGAGATCTTGCAGTGG - Intergenic
983948273 4:173610327-173610349 CCATATGTGAAATGGTTAAAGGG - Intergenic
984397783 4:179223175-179223197 TCAGATGTGATATCTTTGCAAGG + Intergenic
984607957 4:181806478-181806500 TAAGATGTGAGAGCTTTAAGAGG + Intergenic
985775098 5:1837318-1837340 CCCGAAGTGAGGTCTTTACAAGG + Intergenic
986857827 5:11891606-11891628 ACAGATGAGAGATCTACAAAAGG + Intronic
987126933 5:14821997-14822019 CTAAATGTCAGATCTTGAAAAGG - Intronic
987321804 5:16777295-16777317 CAGGTTGTGACATCTTTAAAAGG + Intronic
988948986 5:36239298-36239320 CCAGATGAGAGATTATTAACAGG - Intronic
992370364 5:76137514-76137536 GCAGATGTGAGATTCTGAAAAGG + Intronic
992738209 5:79745121-79745143 CCAGAGGTCAATTCTTTAAAAGG + Intronic
992753144 5:79879518-79879540 CCAGTTGTGATACCTTTCAAGGG + Intergenic
993319134 5:86451427-86451449 TAAGAGGTGAGGTCTTTAAAAGG + Intergenic
993395832 5:87387178-87387200 TCAGATGTGATAGCTTTAAAAGG - Intronic
993540858 5:89149656-89149678 CCAGATGGGAGAAATTAAAATGG + Intergenic
994184123 5:96799656-96799678 ACAGAAGTGAGTTCTTTAATTGG - Intronic
995174110 5:109154322-109154344 CCAGTTTTGAGAACATTAAATGG + Intronic
996483638 5:124004131-124004153 TGAAAGGTGAGATCTTTAAAAGG - Intergenic
997020283 5:129992553-129992575 ACAGATGTTAGATTTTTAAATGG + Intronic
999018393 5:148135108-148135130 CCAGAGTAGAGGTCTTTAAATGG - Intronic
999625650 5:153517564-153517586 CCAGCTGTGATCTCTTTATAAGG - Intronic
1004090972 6:12501108-12501130 CCAGAGGAGAGATCTTTCATGGG - Intergenic
1004435759 6:15591513-15591535 TCATATTTGAGATCTTTAATTGG + Intronic
1006214159 6:32424855-32424877 CCATATGAAAGATTTTTAAATGG - Intergenic
1007667375 6:43523167-43523189 CAAGATGTGTGAACTCTAAAGGG + Exonic
1008274750 6:49529777-49529799 CCAGATCTGAGATTTTTCCAGGG - Intergenic
1009960769 6:70517716-70517738 CCAGTAGTGTGATCTTTAATGGG + Intronic
1010740496 6:79497393-79497415 CCAGATGTGATACCTTAAGAAGG + Intronic
1011771928 6:90682884-90682906 ATAGAAGTGAGATCTTGAAAGGG - Intergenic
1013540603 6:111104353-111104375 ACAGATGTGAGACATTTCAAAGG + Intronic
1013971317 6:116022966-116022988 CCAGATGTTGAATTTTTAAATGG + Intronic
1015370372 6:132444145-132444167 CTAGAGGTGAGATCGGTAAATGG - Intergenic
1017215876 6:151905888-151905910 ACAGATGTGAGACATTTCAAGGG + Intronic
1019495235 7:1335301-1335323 CAAGATGTGAGATTTGGAAATGG + Intergenic
1021349456 7:19572682-19572704 CCAGATATAAAATCTTCAAAAGG - Intergenic
1021445499 7:20729439-20729461 CCAAATGTGACATTTTTGAAGGG - Intronic
1022688188 7:32616434-32616456 CCAGATGTGATACCCTGAAAAGG - Intergenic
1025703991 7:63845766-63845788 ACAGAAGTGACATTTTTAAAAGG - Intergenic
1026423248 7:70262444-70262466 TAAGATGTCAGGTCTTTAAAAGG - Intronic
1027453963 7:78364061-78364083 CCAGCTGTGAGATCTTGAGTAGG - Intronic
1028878641 7:95853219-95853241 TAAGAAGTGAGATCTTTAAGAGG + Intronic
1030334983 7:108316095-108316117 TCAGAGGTGGGATCTTTAAGAGG + Intronic
1031270040 7:119636681-119636703 CCATATATGAAATTTTTAAAAGG - Intergenic
1034036569 7:147829929-147829951 GCAGATGTGAGATTTCTACAGGG - Intronic
1034707960 7:153163299-153163321 CCTGATGTGAGATCTTAGGATGG + Intergenic
1034784091 7:153909557-153909579 TCAGATGGGAGATTTTTAAGAGG - Intronic
1035895651 8:3397511-3397533 CCAGATGTGTGATATACAAATGG - Intronic
1036162546 8:6403162-6403184 TAAGATGAGAGATCTGTAAAAGG - Intergenic
1037060337 8:14501017-14501039 CTTGAGGTCAGATCTTTAAAGGG + Intronic
1037211975 8:16399822-16399844 CCATTTGTGAGTTCTTTATAAGG + Intronic
1037545759 8:19920194-19920216 CCACAGGTGAGACCTTTAAGAGG + Intronic
1039075230 8:33684715-33684737 CTAGATCTTAGATCTTTGAATGG - Intergenic
1040089401 8:43381589-43381611 CCAAATGTGAGAAATTTTAATGG - Intergenic
1040402709 8:47068360-47068382 CCAAATGTGAGAAATTTTAATGG + Intergenic
1040912504 8:52533922-52533944 CCAGATGTTCTAACTTTAAAAGG + Intergenic
1041206564 8:55504986-55505008 CCAAAAGTTAGTTCTTTAAAAGG - Intronic
1041835036 8:62202093-62202115 GCAGGTGTGAGAAGTTTAAAAGG + Intergenic
1042392870 8:68256154-68256176 CCATATGTGAGAATTTTCAAAGG + Intergenic
1044222557 8:89686332-89686354 CCACATGTGTGTTATTTAAAGGG - Intergenic
1048099952 8:131340462-131340484 GCAGATGTGGGATCTGTAAAAGG + Intergenic
1049768373 8:144366564-144366586 CCAGAGGTGGGACCTTTAAGAGG - Intergenic
1050002289 9:1090537-1090559 CCAGATGTGATATTTTGAGAAGG + Intergenic
1055727830 9:79250617-79250639 CCTGATGTTAGATGTTTAAGGGG + Intergenic
1056292144 9:85154440-85154462 CGTGTTGGGAGATCTTTAAAAGG - Intergenic
1059573970 9:115470268-115470290 CCGGATGTGAGATTTTTCCAAGG + Intergenic
1061289842 9:129644413-129644435 CCAGATGAAACATTTTTAAATGG + Intergenic
1186143887 X:6605534-6605556 TCATATGTAAAATCTTTAAAAGG - Intergenic
1186198048 X:7129748-7129770 CCAGATGTGAGATCTTTAAAAGG - Intronic
1187158219 X:16741078-16741100 CCAGATGTGGTATCTTGAGAAGG - Intronic
1187608557 X:20914752-20914774 TGAGAGGTGAGATCTTTAAGAGG + Intergenic
1187934939 X:24326925-24326947 CCAGATGTGATACCCTTAGAAGG + Intergenic
1188032726 X:25282398-25282420 CCAGATGTGGGACTTTTAAGAGG + Intergenic
1188804313 X:34569303-34569325 ACAGATGTGAGATTTTGAAGGGG - Intergenic
1190309766 X:49108757-49108779 TAAGAGGTGAGATCTTTAAGAGG + Intergenic
1194121452 X:89968389-89968411 CCAGAAGTTGGATCTTTGAAAGG - Intergenic
1196699882 X:118656589-118656611 CAAGATATGAGAACCTTAAACGG + Intronic
1198832736 X:140767942-140767964 TAAGAGGTGAGATCTTTAAGAGG - Intergenic
1201571652 Y:15421815-15421837 CCAGATGTGAGATCTTTAAAAGG - Intergenic