ID: 1201571655

View in Genome Browser
Species Human (GRCh38)
Location Y:15421836-15421858
Sequence GGGCCACAGAACTTCTGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201571652_1201571655 -2 Left 1201571652 Y:15421815-15421837 CCTTTTAAAGATCTCACATCTGG 0: 2
1: 0
2: 0
3: 21
4: 244
Right 1201571655 Y:15421836-15421858 GGGCCACAGAACTTCTGTGAAGG No data
1201571651_1201571655 17 Left 1201571651 Y:15421796-15421818 CCTTATTCAAAAACACTGACCTT 0: 2
1: 0
2: 1
3: 22
4: 289
Right 1201571655 Y:15421836-15421858 GGGCCACAGAACTTCTGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201571655 Original CRISPR GGGCCACAGAACTTCTGTGA AGG Intergenic
No off target data available for this crispr