ID: 1201574436

View in Genome Browser
Species Human (GRCh38)
Location Y:15446901-15446923
Sequence CCTTTTCAGCAGTGTCTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201574436_1201574441 3 Left 1201574436 Y:15446901-15446923 CCTGCCAGACACTGCTGAAAAGG No data
Right 1201574441 Y:15446927-15446949 GTAAAGAGGAAACACACAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201574436 Original CRISPR CCTTTTCAGCAGTGTCTGGC AGG (reversed) Intergenic
No off target data available for this crispr