ID: 1201574441

View in Genome Browser
Species Human (GRCh38)
Location Y:15446927-15446949
Sequence GTAAAGAGGAAACACACAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201574436_1201574441 3 Left 1201574436 Y:15446901-15446923 CCTGCCAGACACTGCTGAAAAGG No data
Right 1201574441 Y:15446927-15446949 GTAAAGAGGAAACACACAGATGG No data
1201574439_1201574441 -1 Left 1201574439 Y:15446905-15446927 CCAGACACTGCTGAAAAGGGATG No data
Right 1201574441 Y:15446927-15446949 GTAAAGAGGAAACACACAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201574441 Original CRISPR GTAAAGAGGAAACACACAGA TGG Intergenic
No off target data available for this crispr