ID: 1201575320

View in Genome Browser
Species Human (GRCh38)
Location Y:15456171-15456193
Sequence GCCCTGAGTGCGCGTGCGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201575320_1201575331 21 Left 1201575320 Y:15456171-15456193 CCCCGCGCACGCGCACTCAGGGC No data
Right 1201575331 Y:15456215-15456237 GTCGGCTTATGAGCATCTGGCGG No data
1201575320_1201575325 -1 Left 1201575320 Y:15456171-15456193 CCCCGCGCACGCGCACTCAGGGC No data
Right 1201575325 Y:15456193-15456215 CCTCTTCGCGCCTTCCTGGCCGG No data
1201575320_1201575323 -5 Left 1201575320 Y:15456171-15456193 CCCCGCGCACGCGCACTCAGGGC No data
Right 1201575323 Y:15456189-15456211 AGGGCCTCTTCGCGCCTTCCTGG No data
1201575320_1201575330 18 Left 1201575320 Y:15456171-15456193 CCCCGCGCACGCGCACTCAGGGC No data
Right 1201575330 Y:15456212-15456234 CCGGTCGGCTTATGAGCATCTGG No data
1201575320_1201575326 3 Left 1201575320 Y:15456171-15456193 CCCCGCGCACGCGCACTCAGGGC No data
Right 1201575326 Y:15456197-15456219 TTCGCGCCTTCCTGGCCGGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201575320 Original CRISPR GCCCTGAGTGCGCGTGCGCG GGG (reversed) Intergenic