ID: 1201584730

View in Genome Browser
Species Human (GRCh38)
Location Y:15548247-15548269
Sequence CAAGATGGCCACCTGTGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201584730_1201584742 25 Left 1201584730 Y:15548247-15548269 CCACCCCACAGGTGGCCATCTTG No data
Right 1201584742 Y:15548295-15548317 TTGCTTCACAGTGAGGAAGCTGG No data
1201584730_1201584744 29 Left 1201584730 Y:15548247-15548269 CCACCCCACAGGTGGCCATCTTG No data
Right 1201584744 Y:15548299-15548321 TTCACAGTGAGGAAGCTGGTGGG No data
1201584730_1201584743 28 Left 1201584730 Y:15548247-15548269 CCACCCCACAGGTGGCCATCTTG No data
Right 1201584743 Y:15548298-15548320 CTTCACAGTGAGGAAGCTGGTGG No data
1201584730_1201584741 18 Left 1201584730 Y:15548247-15548269 CCACCCCACAGGTGGCCATCTTG No data
Right 1201584741 Y:15548288-15548310 CATATCATTGCTTCACAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201584730 Original CRISPR CAAGATGGCCACCTGTGGGG TGG (reversed) Intergenic
No off target data available for this crispr