ID: 1201584741

View in Genome Browser
Species Human (GRCh38)
Location Y:15548288-15548310
Sequence CATATCATTGCTTCACAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201584735_1201584741 13 Left 1201584735 Y:15548252-15548274 CCACAGGTGGCCATCTTGGAGGG No data
Right 1201584741 Y:15548288-15548310 CATATCATTGCTTCACAGTGAGG No data
1201584733_1201584741 14 Left 1201584733 Y:15548251-15548273 CCCACAGGTGGCCATCTTGGAGG No data
Right 1201584741 Y:15548288-15548310 CATATCATTGCTTCACAGTGAGG No data
1201584738_1201584741 3 Left 1201584738 Y:15548262-15548284 CCATCTTGGAGGGGAGCCTAGTT No data
Right 1201584741 Y:15548288-15548310 CATATCATTGCTTCACAGTGAGG No data
1201584732_1201584741 15 Left 1201584732 Y:15548250-15548272 CCCCACAGGTGGCCATCTTGGAG No data
Right 1201584741 Y:15548288-15548310 CATATCATTGCTTCACAGTGAGG No data
1201584730_1201584741 18 Left 1201584730 Y:15548247-15548269 CCACCCCACAGGTGGCCATCTTG No data
Right 1201584741 Y:15548288-15548310 CATATCATTGCTTCACAGTGAGG No data
1201584729_1201584741 19 Left 1201584729 Y:15548246-15548268 CCCACCCCACAGGTGGCCATCTT No data
Right 1201584741 Y:15548288-15548310 CATATCATTGCTTCACAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201584741 Original CRISPR CATATCATTGCTTCACAGTG AGG Intergenic
No off target data available for this crispr