ID: 1201584742

View in Genome Browser
Species Human (GRCh38)
Location Y:15548295-15548317
Sequence TTGCTTCACAGTGAGGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201584739_1201584742 -6 Left 1201584739 Y:15548278-15548300 CCTAGTTAGCCATATCATTGCTT No data
Right 1201584742 Y:15548295-15548317 TTGCTTCACAGTGAGGAAGCTGG No data
1201584732_1201584742 22 Left 1201584732 Y:15548250-15548272 CCCCACAGGTGGCCATCTTGGAG No data
Right 1201584742 Y:15548295-15548317 TTGCTTCACAGTGAGGAAGCTGG No data
1201584729_1201584742 26 Left 1201584729 Y:15548246-15548268 CCCACCCCACAGGTGGCCATCTT No data
Right 1201584742 Y:15548295-15548317 TTGCTTCACAGTGAGGAAGCTGG No data
1201584733_1201584742 21 Left 1201584733 Y:15548251-15548273 CCCACAGGTGGCCATCTTGGAGG No data
Right 1201584742 Y:15548295-15548317 TTGCTTCACAGTGAGGAAGCTGG No data
1201584730_1201584742 25 Left 1201584730 Y:15548247-15548269 CCACCCCACAGGTGGCCATCTTG No data
Right 1201584742 Y:15548295-15548317 TTGCTTCACAGTGAGGAAGCTGG No data
1201584735_1201584742 20 Left 1201584735 Y:15548252-15548274 CCACAGGTGGCCATCTTGGAGGG No data
Right 1201584742 Y:15548295-15548317 TTGCTTCACAGTGAGGAAGCTGG No data
1201584738_1201584742 10 Left 1201584738 Y:15548262-15548284 CCATCTTGGAGGGGAGCCTAGTT No data
Right 1201584742 Y:15548295-15548317 TTGCTTCACAGTGAGGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201584742 Original CRISPR TTGCTTCACAGTGAGGAAGC TGG Intergenic
No off target data available for this crispr