ID: 1201589093

View in Genome Browser
Species Human (GRCh38)
Location Y:15593836-15593858
Sequence GTGCTGTGCTAAAAGAGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201589093_1201589095 6 Left 1201589093 Y:15593836-15593858 CCCTCACTCTTTTAGCACAGCAC No data
Right 1201589095 Y:15593865-15593887 CTTGAGAATGAATGAGTATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201589093 Original CRISPR GTGCTGTGCTAAAAGAGTGA GGG (reversed) Intergenic
No off target data available for this crispr