ID: 1201589879

View in Genome Browser
Species Human (GRCh38)
Location Y:15603391-15603413
Sequence CTTTATTAGCAGAATGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201589879_1201589880 1 Left 1201589879 Y:15603391-15603413 CCATTCTCATTCTGCTAATAAAG No data
Right 1201589880 Y:15603415-15603437 CATACTTGAGAAATTTATAAAGG No data
1201589879_1201589881 8 Left 1201589879 Y:15603391-15603413 CCATTCTCATTCTGCTAATAAAG No data
Right 1201589881 Y:15603422-15603444 GAGAAATTTATAAAGGAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201589879 Original CRISPR CTTTATTAGCAGAATGAGAA TGG (reversed) Intergenic
No off target data available for this crispr