ID: 1201593641

View in Genome Browser
Species Human (GRCh38)
Location Y:15641935-15641957
Sequence ATTGAGATGGAGAGTGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201593635_1201593641 0 Left 1201593635 Y:15641912-15641934 CCAGGGATTAGAGTGTGGACATT No data
Right 1201593641 Y:15641935-15641957 ATTGAGATGGAGAGTGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201593641 Original CRISPR ATTGAGATGGAGAGTGGGGA GGG Intergenic
No off target data available for this crispr