ID: 1201595098

View in Genome Browser
Species Human (GRCh38)
Location Y:15659524-15659546
Sequence TGTGATGTTAGCACGTCCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201595098_1201595101 8 Left 1201595098 Y:15659524-15659546 CCAATGGACGTGCTAACATCACA No data
Right 1201595101 Y:15659555-15659577 TTGTTTGGCTGTAGGTAACAAGG No data
1201595098_1201595104 30 Left 1201595098 Y:15659524-15659546 CCAATGGACGTGCTAACATCACA No data
Right 1201595104 Y:15659577-15659599 GCTCCCACAGTGGGAAAACCAGG No data
1201595098_1201595100 0 Left 1201595098 Y:15659524-15659546 CCAATGGACGTGCTAACATCACA No data
Right 1201595100 Y:15659547-15659569 GATGATTTTTGTTTGGCTGTAGG No data
1201595098_1201595099 -7 Left 1201595098 Y:15659524-15659546 CCAATGGACGTGCTAACATCACA No data
Right 1201595099 Y:15659540-15659562 CATCACAGATGATTTTTGTTTGG No data
1201595098_1201595102 20 Left 1201595098 Y:15659524-15659546 CCAATGGACGTGCTAACATCACA No data
Right 1201595102 Y:15659567-15659589 AGGTAACAAGGCTCCCACAGTGG No data
1201595098_1201595103 21 Left 1201595098 Y:15659524-15659546 CCAATGGACGTGCTAACATCACA No data
Right 1201595103 Y:15659568-15659590 GGTAACAAGGCTCCCACAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201595098 Original CRISPR TGTGATGTTAGCACGTCCAT TGG (reversed) Intergenic
No off target data available for this crispr