ID: 1201595103

View in Genome Browser
Species Human (GRCh38)
Location Y:15659568-15659590
Sequence GGTAACAAGGCTCCCACAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201595098_1201595103 21 Left 1201595098 Y:15659524-15659546 CCAATGGACGTGCTAACATCACA No data
Right 1201595103 Y:15659568-15659590 GGTAACAAGGCTCCCACAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201595103 Original CRISPR GGTAACAAGGCTCCCACAGT GGG Intergenic
No off target data available for this crispr