ID: 1201596444

View in Genome Browser
Species Human (GRCh38)
Location Y:15675257-15675279
Sequence GGGTATTCAAATACAAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201596441_1201596444 22 Left 1201596441 Y:15675212-15675234 CCACAGCAGTCAGGCAAAAAAAA No data
Right 1201596444 Y:15675257-15675279 GGGTATTCAAATACAAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201596444 Original CRISPR GGGTATTCAAATACAAAAAC AGG Intergenic
No off target data available for this crispr