ID: 1201597621

View in Genome Browser
Species Human (GRCh38)
Location Y:15689557-15689579
Sequence ACATTCTATAAGGGTAGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201597617_1201597621 7 Left 1201597617 Y:15689527-15689549 CCTCACATGATGCCACATGTTGA No data
Right 1201597621 Y:15689557-15689579 ACATTCTATAAGGGTAGAGCAGG No data
1201597616_1201597621 13 Left 1201597616 Y:15689521-15689543 CCATCTCCTCACATGATGCCACA No data
Right 1201597621 Y:15689557-15689579 ACATTCTATAAGGGTAGAGCAGG No data
1201597618_1201597621 -5 Left 1201597618 Y:15689539-15689561 CCACATGTTGAGATGATGACATT No data
Right 1201597621 Y:15689557-15689579 ACATTCTATAAGGGTAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201597621 Original CRISPR ACATTCTATAAGGGTAGAGC AGG Intergenic
No off target data available for this crispr