ID: 1201602089

View in Genome Browser
Species Human (GRCh38)
Location Y:15742379-15742401
Sequence CACGATGTGCACATGTACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201602089_1201602091 13 Left 1201602089 Y:15742379-15742401 CCAGGGTACATGTGCACATCGTG No data
Right 1201602091 Y:15742415-15742437 TATGCACACATGTACCATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201602089 Original CRISPR CACGATGTGCACATGTACCC TGG (reversed) Intergenic
No off target data available for this crispr