ID: 1201602712

View in Genome Browser
Species Human (GRCh38)
Location Y:15748655-15748677
Sequence AGTTATGAATTGAACTCATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201602712_1201602721 26 Left 1201602712 Y:15748655-15748677 CCAAATGAGTTCAATTCATAACT No data
Right 1201602721 Y:15748704-15748726 GCTGGCTCTTTGAGTGGCCTAGG No data
1201602712_1201602722 27 Left 1201602712 Y:15748655-15748677 CCAAATGAGTTCAATTCATAACT No data
Right 1201602722 Y:15748705-15748727 CTGGCTCTTTGAGTGGCCTAGGG No data
1201602712_1201602719 20 Left 1201602712 Y:15748655-15748677 CCAAATGAGTTCAATTCATAACT No data
Right 1201602719 Y:15748698-15748720 TGACCTGCTGGCTCTTTGAGTGG No data
1201602712_1201602715 8 Left 1201602712 Y:15748655-15748677 CCAAATGAGTTCAATTCATAACT No data
Right 1201602715 Y:15748686-15748708 GGACCCCTGGACTGACCTGCTGG No data
1201602712_1201602714 -5 Left 1201602712 Y:15748655-15748677 CCAAATGAGTTCAATTCATAACT No data
Right 1201602714 Y:15748673-15748695 TAACTTCTACGAAGGACCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201602712 Original CRISPR AGTTATGAATTGAACTCATT TGG (reversed) Intergenic
No off target data available for this crispr