ID: 1201602718

View in Genome Browser
Species Human (GRCh38)
Location Y:15748691-15748713
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201602718_1201602722 -9 Left 1201602718 Y:15748691-15748713 CCTGGACTGACCTGCTGGCTCTT No data
Right 1201602722 Y:15748705-15748727 CTGGCTCTTTGAGTGGCCTAGGG No data
1201602718_1201602721 -10 Left 1201602718 Y:15748691-15748713 CCTGGACTGACCTGCTGGCTCTT No data
Right 1201602721 Y:15748704-15748726 GCTGGCTCTTTGAGTGGCCTAGG No data
1201602718_1201602729 23 Left 1201602718 Y:15748691-15748713 CCTGGACTGACCTGCTGGCTCTT No data
Right 1201602729 Y:15748737-15748759 CTGGAGGATGCTACAACTGCAGG No data
1201602718_1201602730 24 Left 1201602718 Y:15748691-15748713 CCTGGACTGACCTGCTGGCTCTT No data
Right 1201602730 Y:15748738-15748760 TGGAGGATGCTACAACTGCAGGG No data
1201602718_1201602725 7 Left 1201602718 Y:15748691-15748713 CCTGGACTGACCTGCTGGCTCTT No data
Right 1201602725 Y:15748721-15748743 CCTAGGGAGTTCCCCTCTGGAGG No data
1201602718_1201602723 4 Left 1201602718 Y:15748691-15748713 CCTGGACTGACCTGCTGGCTCTT No data
Right 1201602723 Y:15748718-15748740 TGGCCTAGGGAGTTCCCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201602718 Original CRISPR AAGAGCCAGCAGGTCAGTCC AGG (reversed) Intergenic
No off target data available for this crispr