ID: 1201602722

View in Genome Browser
Species Human (GRCh38)
Location Y:15748705-15748727
Sequence CTGGCTCTTTGAGTGGCCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201602711_1201602722 28 Left 1201602711 Y:15748654-15748676 CCCAAATGAGTTCAATTCATAAC No data
Right 1201602722 Y:15748705-15748727 CTGGCTCTTTGAGTGGCCTAGGG No data
1201602710_1201602722 29 Left 1201602710 Y:15748653-15748675 CCCCAAATGAGTTCAATTCATAA No data
Right 1201602722 Y:15748705-15748727 CTGGCTCTTTGAGTGGCCTAGGG No data
1201602717_1201602722 -8 Left 1201602717 Y:15748690-15748712 CCCTGGACTGACCTGCTGGCTCT No data
Right 1201602722 Y:15748705-15748727 CTGGCTCTTTGAGTGGCCTAGGG No data
1201602712_1201602722 27 Left 1201602712 Y:15748655-15748677 CCAAATGAGTTCAATTCATAACT No data
Right 1201602722 Y:15748705-15748727 CTGGCTCTTTGAGTGGCCTAGGG No data
1201602718_1201602722 -9 Left 1201602718 Y:15748691-15748713 CCTGGACTGACCTGCTGGCTCTT No data
Right 1201602722 Y:15748705-15748727 CTGGCTCTTTGAGTGGCCTAGGG No data
1201602716_1201602722 -7 Left 1201602716 Y:15748689-15748711 CCCCTGGACTGACCTGCTGGCTC No data
Right 1201602722 Y:15748705-15748727 CTGGCTCTTTGAGTGGCCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201602722 Original CRISPR CTGGCTCTTTGAGTGGCCTA GGG Intergenic
No off target data available for this crispr