ID: 1201602730

View in Genome Browser
Species Human (GRCh38)
Location Y:15748738-15748760
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201602720_1201602730 14 Left 1201602720 Y:15748701-15748723 CCTGCTGGCTCTTTGAGTGGCCT No data
Right 1201602730 Y:15748738-15748760 TGGAGGATGCTACAACTGCAGGG No data
1201602717_1201602730 25 Left 1201602717 Y:15748690-15748712 CCCTGGACTGACCTGCTGGCTCT No data
Right 1201602730 Y:15748738-15748760 TGGAGGATGCTACAACTGCAGGG No data
1201602716_1201602730 26 Left 1201602716 Y:15748689-15748711 CCCCTGGACTGACCTGCTGGCTC No data
Right 1201602730 Y:15748738-15748760 TGGAGGATGCTACAACTGCAGGG No data
1201602724_1201602730 -6 Left 1201602724 Y:15748721-15748743 CCTAGGGAGTTCCCCTCTGGAGG No data
Right 1201602730 Y:15748738-15748760 TGGAGGATGCTACAACTGCAGGG No data
1201602718_1201602730 24 Left 1201602718 Y:15748691-15748713 CCTGGACTGACCTGCTGGCTCTT No data
Right 1201602730 Y:15748738-15748760 TGGAGGATGCTACAACTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201602730 Original CRISPR TGGAGGATGCTACAACTGCA GGG Intergenic
No off target data available for this crispr