ID: 1201606992

View in Genome Browser
Species Human (GRCh38)
Location Y:15797985-15798007
Sequence ATGTATTTGAATCAGGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201606992_1201607001 5 Left 1201606992 Y:15797985-15798007 CCATCCCCCTGATTCAAATACAT No data
Right 1201607001 Y:15798013-15798035 TGGGCCTTTCCCGTGACATGTGG No data
1201606992_1201607002 6 Left 1201606992 Y:15797985-15798007 CCATCCCCCTGATTCAAATACAT No data
Right 1201607002 Y:15798014-15798036 GGGCCTTTCCCGTGACATGTGGG No data
1201606992_1201607003 7 Left 1201606992 Y:15797985-15798007 CCATCCCCCTGATTCAAATACAT No data
Right 1201607003 Y:15798015-15798037 GGCCTTTCCCGTGACATGTGGGG No data
1201606992_1201607006 14 Left 1201606992 Y:15797985-15798007 CCATCCCCCTGATTCAAATACAT No data
Right 1201607006 Y:15798022-15798044 CCCGTGACATGTGGGGATTATGG 0: 18
1: 552
2: 1409
3: 2822
4: 4072
1201606992_1201607008 15 Left 1201606992 Y:15797985-15798007 CCATCCCCCTGATTCAAATACAT No data
Right 1201607008 Y:15798023-15798045 CCGTGACATGTGGGGATTATGGG 0: 17
1: 559
2: 1448
3: 2830
4: 4122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201606992 Original CRISPR ATGTATTTGAATCAGGGGGA TGG (reversed) Intergenic
No off target data available for this crispr