ID: 1201626479

View in Genome Browser
Species Human (GRCh38)
Location Y:16020425-16020447
Sequence CAGGGTAATCAGACAGGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 9099
Summary {0: 2, 1: 65, 2: 2951, 3: 4590, 4: 1491}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201626479_1201626485 12 Left 1201626479 Y:16020425-16020447 CCTTCTCCTGTCTGATTACCCTG 0: 2
1: 65
2: 2951
3: 4590
4: 1491
Right 1201626485 Y:16020460-16020482 AACACTACGTTGAATAGCAGCGG No data
1201626479_1201626486 22 Left 1201626479 Y:16020425-16020447 CCTTCTCCTGTCTGATTACCCTG 0: 2
1: 65
2: 2951
3: 4590
4: 1491
Right 1201626486 Y:16020470-16020492 TGAATAGCAGCGGTGAGAGAAGG 0: 2
1: 810
2: 10751
3: 5306
4: 4231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201626479 Original CRISPR CAGGGTAATCAGACAGGAGA AGG (reversed) Intergenic
Too many off-targets to display for this crispr