ID: 1201639660

View in Genome Browser
Species Human (GRCh38)
Location Y:16165593-16165615
Sequence GTGGATAAGTTCCACTATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201639653_1201639660 7 Left 1201639653 Y:16165563-16165585 CCGATTAATTTGGTGGTGTTTAG No data
Right 1201639660 Y:16165593-16165615 GTGGATAAGTTCCACTATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201639660 Original CRISPR GTGGATAAGTTCCACTATCT GGG Intergenic
No off target data available for this crispr