ID: 1201640381

View in Genome Browser
Species Human (GRCh38)
Location Y:16171105-16171127
Sequence GAAGAGTCCCAGTACTAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201640381_1201640385 1 Left 1201640381 Y:16171105-16171127 CCTGGTTAGTACTGGGACTCTTC No data
Right 1201640385 Y:16171129-16171151 TCTCTTAGGGTGTCCCCCAAGGG No data
1201640381_1201640384 0 Left 1201640381 Y:16171105-16171127 CCTGGTTAGTACTGGGACTCTTC No data
Right 1201640384 Y:16171128-16171150 TTCTCTTAGGGTGTCCCCCAAGG No data
1201640381_1201640386 6 Left 1201640381 Y:16171105-16171127 CCTGGTTAGTACTGGGACTCTTC No data
Right 1201640386 Y:16171134-16171156 TAGGGTGTCCCCCAAGGGTCAGG No data
1201640381_1201640392 30 Left 1201640381 Y:16171105-16171127 CCTGGTTAGTACTGGGACTCTTC No data
Right 1201640392 Y:16171158-16171180 CCTATTGTGCTCAAAGCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201640381 Original CRISPR GAAGAGTCCCAGTACTAACC AGG (reversed) Intergenic
No off target data available for this crispr