ID: 1201643822

View in Genome Browser
Species Human (GRCh38)
Location Y:16205611-16205633
Sequence CTCTCTAAACTAATCCTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201643822_1201643835 17 Left 1201643822 Y:16205611-16205633 CCAACCAGGATTAGTTTAGAGAG No data
Right 1201643835 Y:16205651-16205673 CAATGGGGAAAGGGTACATATGG No data
1201643822_1201643837 19 Left 1201643822 Y:16205611-16205633 CCAACCAGGATTAGTTTAGAGAG No data
Right 1201643837 Y:16205653-16205675 ATGGGGAAAGGGTACATATGGGG No data
1201643822_1201643838 23 Left 1201643822 Y:16205611-16205633 CCAACCAGGATTAGTTTAGAGAG No data
Right 1201643838 Y:16205657-16205679 GGAAAGGGTACATATGGGGCAGG No data
1201643822_1201643826 1 Left 1201643822 Y:16205611-16205633 CCAACCAGGATTAGTTTAGAGAG No data
Right 1201643826 Y:16205635-16205657 ATGACCCGACCCTGGCCAATGGG No data
1201643822_1201643824 -7 Left 1201643822 Y:16205611-16205633 CCAACCAGGATTAGTTTAGAGAG No data
Right 1201643824 Y:16205627-16205649 TAGAGAGTATGACCCGACCCTGG No data
1201643822_1201643836 18 Left 1201643822 Y:16205611-16205633 CCAACCAGGATTAGTTTAGAGAG No data
Right 1201643836 Y:16205652-16205674 AATGGGGAAAGGGTACATATGGG No data
1201643822_1201643831 8 Left 1201643822 Y:16205611-16205633 CCAACCAGGATTAGTTTAGAGAG No data
Right 1201643831 Y:16205642-16205664 GACCCTGGCCAATGGGGAAAGGG 0: 12
1: 26
2: 31
3: 34
4: 202
1201643822_1201643827 2 Left 1201643822 Y:16205611-16205633 CCAACCAGGATTAGTTTAGAGAG No data
Right 1201643827 Y:16205636-16205658 TGACCCGACCCTGGCCAATGGGG No data
1201643822_1201643825 0 Left 1201643822 Y:16205611-16205633 CCAACCAGGATTAGTTTAGAGAG No data
Right 1201643825 Y:16205634-16205656 TATGACCCGACCCTGGCCAATGG No data
1201643822_1201643830 7 Left 1201643822 Y:16205611-16205633 CCAACCAGGATTAGTTTAGAGAG No data
Right 1201643830 Y:16205641-16205663 CGACCCTGGCCAATGGGGAAAGG 0: 9
1: 18
2: 33
3: 47
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201643822 Original CRISPR CTCTCTAAACTAATCCTGGT TGG (reversed) Intergenic
No off target data available for this crispr