ID: 1201643935

View in Genome Browser
Species Human (GRCh38)
Location Y:16206462-16206484
Sequence CAAAATGCTGGTGGTGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201643935_1201643939 9 Left 1201643935 Y:16206462-16206484 CCAGTAACACCACCAGCATTTTG No data
Right 1201643939 Y:16206494-16206516 TAAAGACTGAGTAATCTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201643935 Original CRISPR CAAAATGCTGGTGGTGTTAC TGG (reversed) Intergenic
No off target data available for this crispr