ID: 1201648868

View in Genome Browser
Species Human (GRCh38)
Location Y:16264079-16264101
Sequence GGGACCTGAACAAAATCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201648868_1201648876 22 Left 1201648868 Y:16264079-16264101 CCTCCAGATTTTGTTCAGGTCCC No data
Right 1201648876 Y:16264124-16264146 TCCTGATATCTGTGGCTGATTGG 0: 59
1: 58
2: 80
3: 64
4: 179
1201648868_1201648875 14 Left 1201648868 Y:16264079-16264101 CCTCCAGATTTTGTTCAGGTCCC No data
Right 1201648875 Y:16264116-16264138 GAGCTTTCTCCTGATATCTGTGG 0: 75
1: 53
2: 28
3: 36
4: 224
1201648868_1201648872 -8 Left 1201648868 Y:16264079-16264101 CCTCCAGATTTTGTTCAGGTCCC No data
Right 1201648872 Y:16264094-16264116 CAGGTCCCAGGGCTCACTTTTGG No data
1201648868_1201648878 23 Left 1201648868 Y:16264079-16264101 CCTCCAGATTTTGTTCAGGTCCC No data
Right 1201648878 Y:16264125-16264147 CCTGATATCTGTGGCTGATTGGG 0: 56
1: 61
2: 80
3: 50
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201648868 Original CRISPR GGGACCTGAACAAAATCTGG AGG (reversed) Intergenic
No off target data available for this crispr