ID: 1201648872

View in Genome Browser
Species Human (GRCh38)
Location Y:16264094-16264116
Sequence CAGGTCCCAGGGCTCACTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201648866_1201648872 7 Left 1201648866 Y:16264064-16264086 CCAGGTTTAATAATGCCTCCAGA 0: 104
1: 99
2: 51
3: 26
4: 120
Right 1201648872 Y:16264094-16264116 CAGGTCCCAGGGCTCACTTTTGG No data
1201648868_1201648872 -8 Left 1201648868 Y:16264079-16264101 CCTCCAGATTTTGTTCAGGTCCC No data
Right 1201648872 Y:16264094-16264116 CAGGTCCCAGGGCTCACTTTTGG No data
1201648864_1201648872 29 Left 1201648864 Y:16264042-16264064 CCTGTTTAGAACACTGAGATTGC No data
Right 1201648872 Y:16264094-16264116 CAGGTCCCAGGGCTCACTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201648872 Original CRISPR CAGGTCCCAGGGCTCACTTT TGG Intergenic
No off target data available for this crispr