ID: 1201648875

View in Genome Browser
Species Human (GRCh38)
Location Y:16264116-16264138
Sequence GAGCTTTCTCCTGATATCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 416
Summary {0: 75, 1: 53, 2: 28, 3: 36, 4: 224}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201648868_1201648875 14 Left 1201648868 Y:16264079-16264101 CCTCCAGATTTTGTTCAGGTCCC No data
Right 1201648875 Y:16264116-16264138 GAGCTTTCTCCTGATATCTGTGG 0: 75
1: 53
2: 28
3: 36
4: 224
1201648874_1201648875 -7 Left 1201648874 Y:16264100-16264122 CCAGGGCTCACTTTTGGAGCTTT 0: 53
1: 46
2: 100
3: 45
4: 191
Right 1201648875 Y:16264116-16264138 GAGCTTTCTCCTGATATCTGTGG 0: 75
1: 53
2: 28
3: 36
4: 224
1201648869_1201648875 11 Left 1201648869 Y:16264082-16264104 CCAGATTTTGTTCAGGTCCCAGG No data
Right 1201648875 Y:16264116-16264138 GAGCTTTCTCCTGATATCTGTGG 0: 75
1: 53
2: 28
3: 36
4: 224
1201648873_1201648875 -6 Left 1201648873 Y:16264099-16264121 CCCAGGGCTCACTTTTGGAGCTT 0: 51
1: 49
2: 101
3: 49
4: 161
Right 1201648875 Y:16264116-16264138 GAGCTTTCTCCTGATATCTGTGG 0: 75
1: 53
2: 28
3: 36
4: 224
1201648866_1201648875 29 Left 1201648866 Y:16264064-16264086 CCAGGTTTAATAATGCCTCCAGA 0: 104
1: 99
2: 51
3: 26
4: 120
Right 1201648875 Y:16264116-16264138 GAGCTTTCTCCTGATATCTGTGG 0: 75
1: 53
2: 28
3: 36
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201648875 Original CRISPR GAGCTTTCTCCTGATATCTG TGG Intergenic
902840998 1:19073810-19073832 GAGCCTTCTCCCGAAGTCTGGGG + Intergenic
904148670 1:28417720-28417742 GAGCTGTCCCCTCTTATCTGTGG - Intronic
905858362 1:41329974-41329996 CAGCTTTCTCCTGGTCCCTGTGG + Intergenic
906217800 1:44054199-44054221 TAGCTTCCTCCTGATGTCAGGGG - Intergenic
906647483 1:47485929-47485951 GCACTTGCTCCTGATAACTGAGG - Intergenic
907842392 1:58170432-58170454 GAGCTTTCTTCTGATATCTGCGG - Intronic
908041170 1:60115218-60115240 GAGCTTTATCCTGAAAGCTATGG + Intergenic
908300459 1:62757056-62757078 GAGCTTTCTCCTGATATCTGCGG - Intergenic
908892241 1:68860885-68860907 CAACTTCCTCCTGATATCAGGGG + Intergenic
910897989 1:92088222-92088244 GAATTTTCTACTGATATGTGTGG + Intronic
911129723 1:94376025-94376047 GAGCTTTCTCCTGATATCTGCGG + Intergenic
911845570 1:102747308-102747330 GAGCTTTTTCCTGATATCTGCGG + Intergenic
913382668 1:118228329-118228351 GAGCTTTCTCCTGATATCTGTGG - Intergenic
913713550 1:121511345-121511367 GGGCTTTCTCCCGATGTCTGTGG - Intergenic
914857744 1:151364760-151364782 GAGCTTTCCCCTAAAATCTTAGG - Intronic
915092954 1:153439307-153439329 GAGCTTTCTCCTGCTTTGGGAGG - Intronic
915260610 1:154674283-154674305 GAGCTTTCTCCTGATATCTGTGG - Intergenic
916083720 1:161253207-161253229 GAGCTTTCTCCTGATATGTGTGG - Intergenic
916652266 1:166843342-166843364 GAGCTTTCTCCTTAGCTCTGTGG + Intronic
917086176 1:171307645-171307667 GAGCTTTCTCCTGATATCTGTGG - Intergenic
917279924 1:173370644-173370666 GAGCTTTCTCCTGATATCTGTGG - Intergenic
917281211 1:173379556-173379578 GAGCTTTCTCCTGATATCTGTGG - Intergenic
917445747 1:175104722-175104744 GAGCTTTCTCCTGATATCTGTGG + Intronic
917756744 1:178108859-178108881 GAGCTTCCTCATGTTATCTACGG - Intronic
919206327 1:194424788-194424810 GAGCTTTCTCCTCATATCTGTGG - Intergenic
919256964 1:195138503-195138525 GAGCTTCCTCCTGATGTCCGTGG - Intergenic
919558697 1:199093051-199093073 GAGCTTTCTCCTGATATCTGCGG - Intergenic
920002552 1:202809775-202809797 GAGCTTCCTCCTTTTTTCTGAGG - Intergenic
920957990 1:210636875-210636897 GAGATATCCCCTGATTTCTGAGG + Intronic
921019742 1:211224981-211225003 GAGCTTTCTCCTGATATCTGTGG - Intergenic
922635878 1:227170566-227170588 GAGCTATCTGTTGACATCTGGGG - Intronic
923934856 1:238748698-238748720 ATGCTTCCTCCTGATATCAGGGG - Intergenic
924419960 1:243898526-243898548 GAACTTTCTCCTGAATGCTGAGG - Intergenic
1063321656 10:5057445-5057467 GAGCTTTCTCCTGATATCTGTGG + Intronic
1063414853 10:5864964-5864986 GAGCTCTCTCCTGATATCTGTGG - Intronic
1066614529 10:37281857-37281879 GAGCTTTCTCCTGATATCTGTGG + Intronic
1068240698 10:54298261-54298283 GAGCTTTCTTTTGATATCTGTGG - Intronic
1068310253 10:55265823-55265845 GAACTTCCTCCTGATATGAGGGG - Intronic
1068950550 10:62772628-62772650 GTGCTTTGTACTGACATCTGTGG - Intergenic
1069365037 10:67687644-67687666 GAGCTTTCTCCTGATATCTGTGG + Intronic
1069965152 10:72109162-72109184 GACCTTTCTCCTTGGATCTGAGG - Intronic
1070855818 10:79607370-79607392 TAGCTTCCTCCTGATATCAGGGG + Intergenic
1071374636 10:84990273-84990295 GACCCTTGTCCTGATTTCTGGGG - Intergenic
1071834911 10:89409158-89409180 GAGCTTTCTCCTGATATCTGTGG - Intronic
1072521024 10:96230278-96230300 GAGCCTGGTCCTGAGATCTGAGG + Intronic
1073316221 10:102582767-102582789 GAGGTTTCTCCTGGTACCTGGGG + Intronic
1073970802 10:109044063-109044085 AAGCTTTCTCCTGATATCTGTGG - Intergenic
1074436714 10:113440484-113440506 GAGCTGCCTCCTGCTCTCTGAGG - Intergenic
1074742600 10:116499647-116499669 GAGCTTTCTCCTGATATCTGTGG + Intergenic
1075146376 10:119886271-119886293 GAGCTTTCTGCTGATATCTGTGG - Intronic
1076854365 10:133108743-133108765 GAGCTGTCTTGGGATATCTGAGG - Intronic
1079074125 11:17373128-17373150 TAGCTTCCTTCTGATATCAGGGG - Exonic
1079821405 11:25135430-25135452 GGTCTTTCTCCTGACATGTGAGG - Intergenic
1081033487 11:38114275-38114297 GAAGTTTCTCCCAATATCTGTGG - Intergenic
1081146055 11:39563462-39563484 GAGCTTTCTCCTGATATCTGTGG - Intergenic
1081339046 11:41904623-41904645 TAGCTTCCTCCTGATGTCAGGGG - Intergenic
1082749345 11:57000243-57000265 CAGCTTCCTCCTGATATTAGGGG + Intergenic
1082906077 11:58309901-58309923 GAGCTTCCTCCTGATATCTGAGG + Intergenic
1084527942 11:69708993-69709015 CAGCTTCCTCCAGACATCTGCGG + Intergenic
1086002785 11:82001291-82001313 TAGCTTCCTCCTGATATCAGAGG + Intergenic
1087319324 11:96639181-96639203 GAGCTTTCTCCTGATAGCTGCGG - Intergenic
1087458939 11:98422213-98422235 TTGGTTTCTCCTGATATCTGAGG + Intergenic
1092472365 12:8791052-8791074 GAGCTTTCTCCTGATATCTGAGG - Intergenic
1092851319 12:12630062-12630084 TAGTTTTCTTCTGATATCTTTGG + Intronic
1093369830 12:18353698-18353720 CAGCTTCCTCCTTATATCAGGGG + Intronic
1093580529 12:20780512-20780534 GAGCTTTCTCCTGATATCTGTGG + Intergenic
1095448070 12:42302260-42302282 CAACTTCCTCCTGATATCAGGGG + Intronic
1097077746 12:56407848-56407870 CAGCTTCCTCTTGATATCAGGGG + Intergenic
1097747332 12:63315595-63315617 TAGCTTCCTCCTGATATCAGGGG + Intergenic
1098055499 12:66500755-66500777 AAGCTTTCACCTGATCTCTATGG - Intronic
1098517895 12:71399393-71399415 GGACTTTCTCCTGAGATCAGAGG - Intronic
1098581883 12:72109713-72109735 GAGACTTCTCCTTATATTTGTGG + Intronic
1099414686 12:82371678-82371700 GAGCTTTCTCCTGATATCTGTGG + Intronic
1099576804 12:84392843-84392865 AAGCTTTCTCCTGATATCAGTGG + Intergenic
1100052897 12:90471729-90471751 TAGCTATCTCCTGGCATCTGAGG + Intergenic
1100092207 12:90985391-90985413 GAGCTTTCTCCTCATATCTGTGG - Intronic
1100530173 12:95455227-95455249 GAGCTTTCTCCTGATATCTGTGG + Intergenic
1101216817 12:102593912-102593934 CAGCTTCCCCCTGATATCAGGGG + Intergenic
1101433739 12:104647718-104647740 GTGATCTCTCCTGATTTCTGTGG + Intronic
1101455604 12:104827231-104827253 TAGCTTCCTCCTGATATCAGGGG - Intronic
1101779724 12:107824499-107824521 GGGCTTTCTCCTGATATCTGCGG - Intergenic
1103039101 12:117680045-117680067 AAGTTTTCTCTTGACATCTGTGG - Intronic
1104306240 12:127613039-127613061 AAGCTTTCTCTTGATATCTGTGG - Intergenic
1104767168 12:131337637-131337659 GAGCTTTCTCCTGATATCTGTGG - Intergenic
1105762545 13:23527616-23527638 GAACTTTCTCCTGATATCTGTGG - Intergenic
1106162757 13:27215499-27215521 GAGCTTTCTCCTCATATCTGTGG - Intergenic
1107490899 13:40879142-40879164 AAGCTTTCTTCTAATATCTTTGG + Intergenic
1108475239 13:50809762-50809784 GAACTTTCTCCTGGCATTTGGGG - Intronic
1108486490 13:50932002-50932024 GAGCTTTCTGATGAGATCAGTGG - Intronic
1108739602 13:53321956-53321978 GTGCTTTCTCCTGGTTTCTAAGG - Intergenic
1108934375 13:55867350-55867372 CAGCTTCCTCCTGGTATCAGGGG + Intergenic
1109095204 13:58105570-58105592 GAGGTTACTACTGATATGTGAGG + Intergenic
1109501089 13:63236660-63236682 GAGCTTTCTCCTGATATCTGTGG - Intergenic
1109834746 13:67842399-67842421 GAGTTATCTCTTGGTATCTGTGG + Intergenic
1110177524 13:72574586-72574608 TATCTTTCCCATGATATCTGTGG + Intergenic
1111292601 13:86187738-86187760 TAACTTCCTCCTGATATCAGGGG - Intergenic
1111372586 13:87336273-87336295 GAACTTTCTCCTGATATCTGTGG - Intergenic
1112265505 13:97919926-97919948 GAGCTTTCACCTCATGGCTGGGG + Intergenic
1112371741 13:98800126-98800148 GACATTTCTCCTGATATCAGAGG - Intronic
1112538437 13:100283575-100283597 GAGCTTTCTCCTGATATCTGTGG - Intronic
1113551443 13:111195998-111196020 GAGCTTTCTCCTGATATCTGCGG + Intronic
1114214093 14:20642697-20642719 AAGGATTCTCCTGATACCTGAGG - Intergenic
1114731561 14:24998460-24998482 GAGATTTCTCCAGCTATCAGTGG - Intronic
1115285400 14:31709156-31709178 GAACTTTCTCCTGATATCTGTGG + Intronic
1115500004 14:34041081-34041103 GAGCTTGCTGCTGCTATCTTGGG + Intronic
1116121250 14:40724225-40724247 CAACTTCCTCCTGATATCAGGGG + Intergenic
1116131140 14:40856532-40856554 CAGCTTCCTCCTAATATCAGGGG - Intergenic
1116288689 14:43005297-43005319 TAACTTTCTTCTGATATCAGGGG - Intergenic
1117031849 14:51680148-51680170 GAGCCTTCTCCTGAAATATAAGG - Intronic
1118350493 14:64970162-64970184 GAGCTATCTCCAGAGAGCTGTGG - Intronic
1120198851 14:81515766-81515788 GAGCTTTCTTCTGATATCTGCGG - Intronic
1120271269 14:82316591-82316613 CTGCTTTCTCCTGCTATGTGAGG + Intergenic
1121678778 14:95775674-95775696 CAGCTCTCTCCTGACAGCTGGGG - Intergenic
1123153400 14:106203507-106203529 GAGTTTTCTCCTAATATCTGGGG + Intergenic
1125089915 15:35778375-35778397 GAGCTTTCTACTGCTTTCTTTGG + Intergenic
1126068254 15:44842998-44843020 GAGATTTCTGCTGTTCTCTGTGG - Intergenic
1126090579 15:45047806-45047828 GAGATTTCTGCTGTTCTCTGTGG + Intronic
1126303322 15:47224954-47224976 GATCCTTGTTCTGATATCTGAGG + Intronic
1127859310 15:62979931-62979953 GAAATTTCTCCTGATTTCTGTGG + Intergenic
1129066535 15:72909269-72909291 TTGCTTTCTGCTTATATCTGAGG - Intergenic
1129317253 15:74752408-74752430 GAACTTTCTCCTGAGAGCTGGGG - Intronic
1131853924 15:96571795-96571817 CAGCCTCCTCCTGAAATCTGTGG - Intergenic
1136049358 16:27639378-27639400 GATCTTTATGCTGCTATCTGTGG + Intronic
1137517568 16:49161189-49161211 AAGCTTTCTCCAGAGATTTGGGG - Intergenic
1138039488 16:53647527-53647549 TTGCTTTCTCCTGATCTCAGAGG + Intronic
1140986590 16:80163710-80163732 GAGTTCTCTCCTGATGGCTGTGG + Intergenic
1142830552 17:2545885-2545907 GGGCTTGCTCCTGAGATCTTTGG - Intergenic
1145782310 17:27571228-27571250 AGGCTTTCTGCTGATTTCTGTGG + Intronic
1145797572 17:27664733-27664755 GAGCCATCTCCTGCCATCTGTGG - Intergenic
1145804163 17:27714590-27714612 GAACTTTCTCCTGATATCTTTGG - Intergenic
1145811961 17:27769664-27769686 GAGCCTTCTCCTGCAAGCTGTGG - Intronic
1146310566 17:31765252-31765274 GAGCTTTCTTCTGATATCTGTGG - Intergenic
1146886191 17:36472496-36472518 CAGCTTTCTCCTGATATCAGGGG + Intergenic
1149073958 17:52575948-52575970 GAGCTTTCTCCTGATATCTGTGG - Intergenic
1149268635 17:54953820-54953842 GAGTTTTCTCTGAATATCTGGGG + Intronic
1149306986 17:55357628-55357650 GAGCTTCCACCTTATAACTGGGG - Intergenic
1149457548 17:56800429-56800451 GAACTTTCTCCTGAGACCAGTGG - Intronic
1153428260 18:4989250-4989272 CAGCTTCCTCCTGATATCAGGGG + Intergenic
1153438106 18:5088228-5088250 GAGCTTTCTCCTGATAGCTGTGG - Intergenic
1154103839 18:11502399-11502421 GAGCTGCCTCCTGAAATCTGAGG + Intergenic
1154106355 18:11527194-11527216 GAGCTTTCTCTTCAGAGCTGAGG + Intergenic
1155343101 18:24832475-24832497 CACCTTTCTTCTGAAATCTGTGG - Intergenic
1155532401 18:26780514-26780536 GCACTTTCTCCTGAGATGTGGGG + Intergenic
1155565518 18:27129774-27129796 GAACTTTCTCTTGAAGTCTGGGG + Intronic
1155787057 18:29914483-29914505 CAGCTTCCTCCTAATATCAGGGG - Intergenic
1157667958 18:49503762-49503784 GAGCTTTCTCTTATTAACTGGGG + Intergenic
1157857509 18:51116068-51116090 GAGCTTTCTTCTGATATCTGTGG + Intergenic
1158131799 18:54160379-54160401 GAGCTCTCTCCTGGATTCTGAGG + Intronic
1158639626 18:59192558-59192580 GTTTTTTCTCCTGATTTCTGTGG - Intergenic
1159773907 18:72582530-72582552 GAGCTTTTTCCTGGGGTCTGAGG + Intronic
1159826712 18:73221563-73221585 AAGTTTTCTCCTTGTATCTGAGG - Intronic
1159967048 18:74605120-74605142 GTGCATTCTCTTGATATTTGGGG + Intronic
1161896285 19:7083785-7083807 GAGTTTGCTCATGTTATCTGAGG - Exonic
1162107968 19:8382242-8382264 GAGCTTTCTCCTGATATCTGTGG - Intronic
1162237421 19:9320200-9320222 GAGCTTTCTCCTGATATCTGCGG + Intergenic
1162859125 19:13492290-13492312 GAGCATTTTCCAGATCTCTGTGG - Intronic
1163916615 19:20245872-20245894 AAGCTTTCTTCTAATATCTTCGG - Intergenic
1164143553 19:22495253-22495275 CAGCTTCCTCCTGATATCAGGGG - Intronic
1164766957 19:30779621-30779643 GAACGTGCTCCGGATATCTGTGG - Intergenic
1165659006 19:37558329-37558351 GAGTTTTCTTTTAATATCTGGGG + Intronic
1165847136 19:38825494-38825516 GAGCTTTCTCCTGATATCTGCGG - Intronic
1167948829 19:53010428-53010450 CAGTTTTCTCCTAATGTCTGGGG - Intergenic
1168379946 19:55911657-55911679 CAGCTTTCTCCTGTTTTCTCAGG - Intronic
925051223 2:817082-817104 GGGCTTTCTCCTGATGTCTCCGG + Intergenic
925949849 2:8899932-8899954 GAGCTTTCTCCTGATATCTGCGG + Intronic
926564790 2:14457109-14457131 TAGCTTTCTCCTAATGTCAGGGG - Intergenic
926786258 2:16521402-16521424 GAGCTTTCTTCTGCATTCTGTGG + Intergenic
926940850 2:18135068-18135090 GAGCTTTCTAATGATAACTTTGG - Intronic
927721695 2:25387362-25387384 GAGGTTTCTCCTCGTACCTGAGG + Exonic
928617573 2:33055208-33055230 GAGCTTTCTCCTGATATCTGTGG + Intronic
929330423 2:40674927-40674949 GAGCTTTCTTCTGATATTCGTGG - Intergenic
930038579 2:47103368-47103390 GAGCTTTCTCCTGATATCTGCGG - Intronic
931704422 2:64935488-64935510 GAGCTGTCTCCAAATATCTGAGG - Intergenic
932880049 2:75492938-75492960 GTGGTTTCTCTTGATTTCTGAGG - Exonic
934867177 2:97823872-97823894 GACCTTCCTCCTGTTATCTGTGG - Intronic
935765090 2:106359074-106359096 CAGTTTTCTCCTGATATCGCTGG + Intergenic
936463107 2:112725959-112725981 GGGCTTTGTCCTGAGAGCTGAGG + Intronic
937597440 2:123687970-123687992 GAGTTTTCTTTTAATATCTGGGG - Intergenic
939622589 2:144438511-144438533 TAGCTTTCTCCTGATCGCTGTGG + Intronic
939801067 2:146708685-146708707 GAGCTTTGTCCAGCTTTCTGTGG + Intergenic
939851901 2:147314156-147314178 GAGCTTTCTTCTGATATCTGTGG - Intergenic
941243463 2:163069529-163069551 GAGCTTTCTCCTGATATCTGTGG - Intergenic
941537512 2:166741388-166741410 GAGCTTTCTCCTGATATCTGTGG + Intergenic
941884487 2:170514170-170514192 CTGCCTTCTCCAGATATCTGAGG + Intronic
942460369 2:176164081-176164103 CAGGTTTCTTTTGATATCTGTGG - Intronic
942799303 2:179858532-179858554 GGGATTTCTCTTGATCTCTGTGG - Intronic
943103026 2:183510190-183510212 GAGCTTTCTCCTGTTATCTGTGG + Intergenic
943441429 2:187932259-187932281 CAGCTTCCTACTGATATCAGGGG + Intergenic
944729046 2:202499686-202499708 GAGCTTTCTCCTGGTATCTGTGG - Intronic
945725465 2:213468070-213468092 CAGCTTCCTCCTGATACCAGGGG + Intronic
948099923 2:235365401-235365423 GAGCTTTCTCAGGCTGTCTGTGG - Intergenic
948301950 2:236914240-236914262 GAGCTTTCTTCTAACATCTAGGG + Intergenic
1172340695 20:34155203-34155225 GAGTTTTCTCTTGATATCTGTGG - Intergenic
1172753905 20:37270121-37270143 GGGCTTTCTCCTGAGATCCTGGG - Intergenic
1172817636 20:37700729-37700751 GAACTTTTTCCAGACATCTGTGG - Intronic
1175035553 20:55997071-55997093 GAGCATCCTCCTGATATTTTAGG + Intergenic
1176123465 20:63464601-63464623 GTGCTTTCTCCTGTTAGCAGTGG - Intronic
1176222818 20:63978211-63978233 GAGCTTTGTCATCATCTCTGGGG + Intronic
1177124672 21:17181596-17181618 CAGCTTCCTCCTGATATCAGGGG - Intergenic
1177430283 21:20983411-20983433 GAGCTTTCTGTTTATACCTGTGG + Intergenic
1177513858 21:22122674-22122696 CAACTTCCTCCTGATATCAGGGG - Intergenic
1178939180 21:36890631-36890653 GAGCTTTCTTTTGATCTCTCTGG - Intronic
1180926558 22:19559267-19559289 GAACTTTCACCTGATTTGTGAGG + Intergenic
1181151409 22:20886010-20886032 GAGCTTCCTCCTGAGGCCTGAGG + Intronic
1181368220 22:22396562-22396584 GCACTTTCTCCTGATTCCTGGGG + Intergenic
1182844495 22:33419191-33419213 GTGAGTTCTCCTGAGATCTGAGG - Intronic
949152308 3:784343-784365 GAGCTTTCTCCTGATAGCTCAGG - Intergenic
950928490 3:16766506-16766528 GAACTTTTTCCTGATATCAGGGG - Intergenic
951020532 3:17777241-17777263 GAGCTTTCTCCTGATATCTGTGG - Intronic
952169497 3:30791335-30791357 AAGCTTTCTCCAGAAATCTTGGG + Intronic
952453071 3:33449417-33449439 GAGCTTTCTCCTGATATCTGTGG - Intergenic
952555003 3:34521531-34521553 GAGCTTTCTACTGATATCTGTGG + Intergenic
952693941 3:36243776-36243798 GAGCTGTCACTTGATATCTATGG - Intergenic
953622894 3:44548147-44548169 GAGCTTTCTCCTGACATCTGGGG + Intergenic
954577419 3:51684269-51684291 TAGCTGTGTCCTGGTATCTGGGG + Intronic
956842915 3:73156728-73156750 GAGCTTTCTCCTGATATCTGTGG + Intergenic
958601428 3:96300558-96300580 GAGCTTTCTCCTGATATCTGCGG - Intergenic
960063732 3:113349298-113349320 GAGCTTTCTCCTGATACCTGTGG - Intronic
960693137 3:120368306-120368328 CAGCTTTCTCCTGATAGATGTGG + Intergenic
960797537 3:121503612-121503634 TAGCTGTCTCTTGTTATCTGTGG + Intronic
961042042 3:123684379-123684401 GAGCCTCCCCTTGATATCTGGGG + Intronic
961261709 3:125607139-125607161 GAGCTTTCTCCTGGTATCTGCGG - Intergenic
963409179 3:144907088-144907110 GAACTTTCTTCTGATCTCTATGG + Intergenic
963525268 3:146408611-146408633 GAGTTTTCTTTTAATATCTGGGG + Intronic
963696793 3:148573611-148573633 GAGCTTTCTCCTGATATCTGTGG - Intergenic
963992251 3:151668163-151668185 AAGCTTTCTCCTGATATCTGTGG + Intergenic
964972272 3:162577298-162577320 GAGCTTTCTCCTGATATTTGCGG - Intergenic
965062787 3:163804361-163804383 GAGCTTTCTCCTGATATCTGTGG - Intergenic
965104195 3:164338305-164338327 GAGTTTTCTCCTCACATCTGGGG + Intergenic
965627783 3:170699080-170699102 AGGCTTTCTTCAGATATCTGTGG + Intronic
966050980 3:175617691-175617713 TAGCTTCCTCCTGATATCAAGGG + Intronic
969046263 4:4338973-4338995 GAGCATTGTTCTGAAATCTGAGG - Intergenic
969585100 4:8087135-8087157 GGGGTTTCTCCTGATTTCTGGGG - Intronic
971281168 4:25243603-25243625 GAGCTTTCTCCTGATATCTGTGG + Intronic
971578509 4:28305791-28305813 GAGACTTCTCCTGATATCTGTGG - Intergenic
971859902 4:32089331-32089353 TAGCTTTCTCCTGATATCAGGGG + Intergenic
972133257 4:35862371-35862393 GAGCTTTCTCCTGATATCTGTGG + Intergenic
973045899 4:45534231-45534253 GAGCTTCCTCCTGATATCTGTGG - Intergenic
973136720 4:46717493-46717515 GAGCTATTTCCTAATATGTGAGG - Intergenic
974139077 4:57860847-57860869 AAGCTTTATCGTGACATCTGTGG + Intergenic
974174537 4:58307133-58307155 GAGCTTTCTCCTGATATCTGTGG - Intergenic
974187353 4:58460875-58460897 CAGCTTTCTCCTGATATCTGTGG - Intergenic
974526588 4:63055628-63055650 GAGCTTTCTCCTGATATATGTGG - Intergenic
974537173 4:63187414-63187436 GAGTTTTCTCCTGATATCTGTGG - Intergenic
974697644 4:65396810-65396832 CAGCTTCCTCCTGATATCAGGGG - Intronic
974788226 4:66650601-66650623 GAGCTTTCTTTAGTTATCTGTGG - Intergenic
974838824 4:67279522-67279544 GAACTTTCTCCTGATATCTGTGG + Intergenic
975048030 4:69827620-69827642 GAGCTTTCTCTTGATATCTGTGG - Intronic
975387010 4:73769643-73769665 CAGCTTCCTCCTGATCTCAGGGG - Intergenic
975396729 4:73883569-73883591 GAGCATTCTTCTTAAATCTGAGG + Intergenic
975595797 4:76047404-76047426 GAGCTTTCTCCTGATATCTGCGG + Intronic
976174279 4:82336260-82336282 GAGCTTTCTCCTGATATCTGCGG + Intergenic
976922169 4:90454337-90454359 CAGCTTCCTTCTGATGTCTGGGG + Intronic
978747208 4:112208224-112208246 GAGCTTTCTCCTGATATCTGTGG - Intergenic
979919797 4:126481517-126481539 CAGCTTCCTCCTGATATCAGGGG - Intergenic
980290868 4:130846435-130846457 GAGCTTTCTCCTGATATCTGTGG + Intergenic
981049337 4:140295251-140295273 GAGCTTACATCTGATATCTTTGG + Intronic
982798454 4:159673134-159673156 CAGCTTCCTCCTGATCTCAGGGG - Intergenic
982877329 4:160665134-160665156 GAGCTTTCTCCTGATGTCTGTGG - Intergenic
982953973 4:161739269-161739291 TGGCATTCTCCTGATATGTGTGG - Intronic
987855784 5:23419130-23419152 GAGTTTTCTTCTGATGTCTAGGG - Intergenic
987929923 5:24389941-24389963 GAGCTTTCTTCTGATATGTGTGG - Intergenic
988357831 5:30200389-30200411 GAGCTTTCTCCTGATATCTGTGG - Intergenic
988591982 5:32557079-32557101 GAGCTTTCTCCTGATATCTGTGG + Intronic
988605467 5:32675200-32675222 GAGCTTTCTCCTGATATCTGTGG + Intergenic
988632412 5:32945219-32945241 GAAGTTTCACCTGAGATCTGGGG - Intergenic
988922968 5:35961764-35961786 CAACTTCCTCCTGATATCAGGGG + Intronic
989957382 5:50373120-50373142 GAGCTTTCTCCTGATATCTGCGG - Intergenic
989964332 5:50450806-50450828 GAGCTTTCTCCTGATATCTGCGG + Intergenic
990062715 5:51671947-51671969 GAGCTTTCCTCTCATATATGTGG + Intergenic
990116765 5:52400080-52400102 GAGCTTTCTTCTGATATCTGTGG - Intergenic
990732417 5:58823682-58823704 GAGCCTGCTCCTGAGGTCTGAGG - Intronic
991690705 5:69222529-69222551 GAACTTTATCCTGAAAGCTGTGG + Intronic
993486086 5:88487826-88487848 GAGCTTTATCCAGATAACTTGGG - Intergenic
994081246 5:95710924-95710946 GAGTTTTCTTTTAATATCTGGGG + Intergenic
994244910 5:97467942-97467964 TAACTTGCTCCTGATATCAGGGG + Intergenic
995583391 5:113623021-113623043 GAGCTTTCTCCTGATGTCTGTGG + Intergenic
995706464 5:114993169-114993191 GAGCTTTCTCCTGACATCTGTGG - Intergenic
995981380 5:118108513-118108535 GAGGTTTCTCATGGTGTCTGGGG - Intergenic
996099198 5:119430064-119430086 AAGCTTTCTCCTGATATCTGTGG + Intergenic
997522733 5:134533626-134533648 CAGCTTTGTCCTGACATCGGTGG - Intronic
998111489 5:139506111-139506133 GAGCTTTCTCCTGATATCTGTGG - Intergenic
998300133 5:141010048-141010070 GAACTTTCTGCAGATTTCTGAGG - Exonic
999398770 5:151248564-151248586 GAGTTTACGTCTGATATCTGGGG + Intronic
1001041843 5:168341828-168341850 GAACTTTCTTCCGTTATCTGTGG - Intronic
1001329076 5:170749512-170749534 CAGCTTGCTCTTGATAACTGCGG + Intergenic
1001573696 5:172748101-172748123 CAGCTTTATCCTGGTATCTGGGG + Intergenic
1004406675 6:15339352-15339374 CAACTTCCTCCTGATATCAGGGG - Intronic
1006221810 6:32497811-32497833 GAGCTTTCTCCTGATTCCTGTGG - Intergenic
1007030063 6:38619199-38619221 GAGCTTTCTCCTGATATCCGTGG - Intronic
1007835829 6:44672890-44672912 CAGCCTACTCCTGAGATCTGTGG - Intergenic
1008058811 6:46974835-46974857 GACCTTACTCCTAATATTTGTGG - Intergenic
1008586964 6:52959254-52959276 GAGCTTTCTCCTGATATCTGCGG + Intergenic
1009385911 6:63084011-63084033 GAGCTTTCTCCTGATATCTGTGG + Intergenic
1009407681 6:63330447-63330469 GAGCTTTCTCCTGATATCTGCGG + Intergenic
1009470830 6:64027410-64027432 GAGTTTCCTCCTGATATCTGTGG - Intronic
1009626576 6:66144065-66144087 TAGTTTCCTCCTGATATCAGGGG + Intergenic
1009872805 6:69470922-69470944 GAGCTTTCTCCTGATATCTGTGG - Intergenic
1010621997 6:78088264-78088286 GACCTTGCTCCTGAATTCTGAGG - Intergenic
1011375019 6:86678601-86678623 GGGCTTTCTCCTGATATCTGTGG + Intergenic
1012834015 6:104242218-104242240 TAGCATACTCCTGATCTCTGTGG - Intergenic
1013977447 6:116093869-116093891 TAGCTTTCTCCTGATATCTGTGG - Intergenic
1014339368 6:120184030-120184052 TATCTTTCTCCTGATATTAGAGG + Intergenic
1014824733 6:126036255-126036277 AGGCTTTCCCTTGATATCTGGGG - Intronic
1015707930 6:136108624-136108646 CATTTTTCTCCTGACATCTGGGG + Intronic
1015869885 6:137765495-137765517 GAGCTTTGTCATGTTTTCTGGGG - Intergenic
1016774607 6:147891715-147891737 GAGCTTTCATCTTAGATCTGGGG - Intergenic
1019042799 6:169120468-169120490 CAGCTTTCTCCTAATATCAGGGG - Intergenic
1020042989 7:5018160-5018182 GAGCTTTCTGGAGCTATCTGGGG + Intronic
1021028336 7:15697737-15697759 GAGGTTTCTTCTGATATTTAAGG - Intergenic
1021756707 7:23859312-23859334 GAGCTTTCTCCTGATGTCTGCGG + Intergenic
1023077938 7:36501976-36501998 GAGCTTTCTCCTGATATCTGTGG + Intergenic
1024870764 7:53959925-53959947 GAGCTTTCTCCTGATATCTGCGG + Intergenic
1026062942 7:67042605-67042627 GAGCTTTCTCCTGAAGGCAGTGG + Intronic
1026380525 7:69794804-69794826 GAGCTCTCTCCTGATCTCTGTGG - Intronic
1026715407 7:72784885-72784907 GAGCTTTCTCCTGAAGGCAGTGG - Intronic
1028975082 7:96904037-96904059 GAAGTTTCTCCTGAGTTCTGTGG + Intergenic
1031973961 7:128082358-128082380 GAGCTGTGTCCTGCCATCTGGGG - Intronic
1032045142 7:128600188-128600210 GACCCTTCCCCTGATATATGAGG + Intergenic
1034237076 7:149580305-149580327 GACCTTTCTCTAGATATTTGGGG - Intergenic
1034579960 7:152033495-152033517 GAGCTTTCTCCTGATATCCACGG + Intronic
1034584603 7:152078055-152078077 GAGGTTTCTTCTGATCTCTCGGG - Intronic
1035683710 8:1507918-1507940 GAGCCTTCTCCTAAAATGTGTGG - Intronic
1035826844 8:2654009-2654031 GGGTTTTCTCCTGAAAACTGTGG - Intergenic
1036993349 8:13626042-13626064 AAGATTTGTCTTGATATCTGAGG + Intergenic
1038135346 8:24779850-24779872 GAGTTTTCTACTGCTCTCTGTGG - Intergenic
1038430763 8:27497606-27497628 GAGCTTTTTCCTGATATCTGCGG + Intronic
1038638806 8:29307766-29307788 GAGCTTTCTCCTGATATCTGCGG - Intergenic
1039046894 8:33458753-33458775 CAGCTTTCTGCTGCTTTCTGTGG - Intronic
1039276026 8:35934791-35934813 GAGCTTTCTCCTGATATCTGTGG - Intergenic
1039659964 8:39450603-39450625 CAGCTTCCTCCTGATATCAGGGG - Intergenic
1040527231 8:48235829-48235851 GAGCTTTCTCCTGATATCTGTGG - Intergenic
1040965041 8:53074307-53074329 GAGGTTTCTCCTGATATTTGTGG + Intergenic
1040999916 8:53440074-53440096 GAGCTTTCTCCTGATATCTGTGG + Intergenic
1041001924 8:53462369-53462391 CAGCTTTCTCCTGATTTCTGTGG - Intergenic
1041005096 8:53490101-53490123 GAGTTTTCTCCTGATAACAAAGG - Intergenic
1042718787 8:71804789-71804811 GCGGTTTCTCCTGAGCTCTGTGG + Intergenic
1042771932 8:72390739-72390761 GAGCTTTCTCCTGATATCTGCGG - Intergenic
1042855701 8:73264832-73264854 GATATTCCTCCAGATATCTGTGG - Intergenic
1042919630 8:73908801-73908823 TAGCTTTCTCCTGATATCTGTGG - Intergenic
1042990082 8:74629596-74629618 GAGCTTACTCCTGTCAGCTGAGG + Intronic
1043236371 8:77873150-77873172 GAGCTATATCCTGATAGCTGTGG + Intergenic
1044005418 8:86931731-86931753 GAGGTTTCTCCTGGTACCTGTGG + Intronic
1044008405 8:86964128-86964150 TAGCTTCCTCCTGATATCAGGGG + Intronic
1044016379 8:87052269-87052291 TAGCTTCCTTCTGATATCAGGGG + Intronic
1044043769 8:87403328-87403350 GAGCATTCTCCTGAAATATATGG + Intronic
1044456614 8:92398104-92398126 GAGCTTTCTCCTGATATCTGCGG + Intergenic
1045927034 8:107586347-107586369 GATATTTTTCCTAATATCTGGGG - Intergenic
1046157922 8:110318163-110318185 CAGCTCTCTCTTGGTATCTGTGG - Intergenic
1046722389 8:117635416-117635438 GTGATTTGTCCTGATAACTGAGG + Intergenic
1048138263 8:131767760-131767782 GTGCATTCTCCTGTTCTCTGGGG - Intergenic
1048754018 8:137714653-137714675 GATCTTTCTTCTGAAATCTTAGG - Intergenic
1050154691 9:2653827-2653849 GTGCTTACAACTGATATCTGTGG - Exonic
1050926349 9:11268404-11268426 CAACTTTCTTCTGATATCAGGGG + Intergenic
1052289507 9:26826142-26826164 GAGCTTTCTCCTGATATCTGCGG - Intergenic
1052347215 9:27421782-27421804 GTGCTTTCTCCAGATGTCGGAGG + Intronic
1052359239 9:27536475-27536497 GTGCTTTCTCCTAGTTTCTGTGG - Intergenic
1052395356 9:27931631-27931653 GTGAGTTCTCATGATATCTGAGG - Intergenic
1052575480 9:30284225-30284247 CAGCTTCCTCCTGATAACAGGGG + Intergenic
1053076926 9:35141298-35141320 CAGTTTCCTCCTGATATCAGGGG - Intergenic
1053492651 9:38521619-38521641 GAGCTGACTCCTGAAAACTGAGG + Intergenic
1055160234 9:73117664-73117686 GAGCTTTGCCTTGATACCTGTGG + Intergenic
1055375608 9:75646194-75646216 CAGCTTCCTCCTGATATCAGGGG + Intergenic
1055914099 9:81382577-81382599 AAGCTTTATCCAGATAACTGGGG + Intergenic
1056392766 9:86154490-86154512 GAACTGTCTCCTGATATCTGTGG + Intergenic
1056851396 9:90087543-90087565 GGCCTTTCTCCTGGTATCTCAGG - Intergenic
1057672885 9:97110554-97110576 GAGCTGACTCCTGAAAACTGAGG + Intergenic
1058723615 9:107781438-107781460 GAGCTGTGTGCTGATGTCTGAGG - Intergenic
1059565803 9:115382106-115382128 CAGCTTCCTCCTGATACCAGAGG - Intronic
1061279009 9:129586402-129586424 AAGCCTTCCCCTGATGTCTGTGG + Intergenic
1186276073 X:7939341-7939363 TAGCTTTTTCCTTATTTCTGTGG + Intergenic
1186541179 X:10402104-10402126 TAGAGTTCTCCTGAGATCTGTGG - Intergenic
1187348110 X:18485743-18485765 CATCTTTCTCCTGATTTCTTAGG + Intronic
1187582810 X:20626893-20626915 AAGCTTCCTCCTGATTTCTTGGG - Intergenic
1188097538 X:26042900-26042922 GAGCTTTCTCCTGATATCTGTGG - Intergenic
1188136533 X:26500257-26500279 GAGCTTTCTCCTGATATCTGTGG - Intergenic
1188533274 X:31165876-31165898 GAGCTTTAGCCTTATCTCTGTGG + Intronic
1189414614 X:40803107-40803129 CAGCTTCTTCCTGATATCAGGGG + Intergenic
1190541479 X:51482405-51482427 GAGCTTTCTCCTGATATCCACGG - Intergenic
1192869997 X:75175966-75175988 GAGCTTTCTCCTGATATCTGCGG + Intergenic
1194124002 X:89991646-89991668 GAGCCTTCTCCTGATTCCTATGG + Intergenic
1195439585 X:104885538-104885560 GAGCTTTCTCCTGATATCTGCGG - Intronic
1195516735 X:105785319-105785341 GACCTTTATTCTTATATCTGTGG - Intergenic
1195552369 X:106184229-106184251 GAGGTTTCTCCTGATACCTGGGG + Intronic
1196127334 X:112114010-112114032 GAGCTTTTTCCTGATATCTGTGG + Intergenic
1196419367 X:115506848-115506870 GAGCTTTCTCCTGATATCTGTGG + Intergenic
1196489000 X:116246287-116246309 GAGCTTTCTCCTGATATCTGTGG - Intergenic
1197513422 X:127397798-127397820 GAGCTTTCTCCTGATATCCGTGG - Intergenic
1198334232 X:135651508-135651530 TGGTTTTCTCCTGATGTCTGGGG - Intergenic
1198339388 X:135699389-135699411 TGGTTTTCTCCTGATATCTGGGG - Intergenic
1198370019 X:135981315-135981337 GTGCGTTCTCAGGATATCTGAGG - Intergenic
1199399542 X:147381038-147381060 GAATTTTCCCCTGATATCTCTGG - Intergenic
1200476890 Y:3649268-3649290 GAGCCTTCTCCTGATTCCTATGG + Intergenic
1200776229 Y:7172574-7172596 GAGCTTTCTTCTGATATCTCTGG - Intergenic
1200846276 Y:7834594-7834616 GAGTTTTCTCCTAATATCTGGGG - Intergenic
1200880788 Y:8209625-8209647 GAGCTTTCTCCCAATATCTGTGG + Intergenic
1200945335 Y:8830112-8830134 GAGCTTTCTCCTGATATCTGTGG - Intergenic
1200966780 Y:9046071-9046093 GAATTTTCTCCTGATATCTGTGG - Intergenic
1201530561 Y:14986243-14986265 GAGCTTTCTCCTGACATCTTTGG - Intergenic
1201555747 Y:15263505-15263527 GAGCTTTCTTCTGATATCTGTGG - Intergenic
1201568571 Y:15391040-15391062 AAGCTTTCTCCTGATATCTGTGG + Intergenic
1201648875 Y:16264116-16264138 GAGCTTTCTCCTGATATCTGTGG + Intergenic
1201653934 Y:16321184-16321206 GAGCTTTCTCCTGATATCTGTGG - Intergenic
1201743982 Y:17351160-17351182 GAACCTTCTCCTGATACCTGTGG + Intergenic
1202086390 Y:21141194-21141216 CAACTTTCTTCTGATATCAGGGG - Intergenic
1202146678 Y:21806101-21806123 GAGCTTTCTCCTGATATCTGTGG + Intergenic
1202242898 Y:22788936-22788958 CAGCCTTCTCCTGATATCTGTGG - Intergenic
1202257837 Y:22939795-22939817 GGAGTTTCTCCTGATGTCTGTGG - Intergenic
1202272043 Y:23082142-23082164 GAGCTTTCTCCTGATAGCTGTGG + Intergenic
1202293983 Y:23338540-23338562 GAGCTTTCTCCTGATAGCTGTGG - Intergenic
1202395885 Y:24422686-24422708 CAGCCTTCTCCTGATATCTGTGG - Intergenic
1202410827 Y:24573542-24573564 GGAGTTTCTCCTGATGTCTGTGG - Intergenic
1202425040 Y:24715886-24715908 GAGCTTTCTCCTGATAGCTGTGG + Intergenic
1202445749 Y:24954199-24954221 GAGCTTTCTCCTGATAGCTGTGG - Intergenic
1202459954 Y:25096530-25096552 GGAGTTTCTCCTGATGTCTGTGG + Intergenic
1202474900 Y:25247406-25247428 CAGCCTTCTCCTGATATCTGTGG + Intergenic