ID: 1201648876

View in Genome Browser
Species Human (GRCh38)
Location Y:16264124-16264146
Sequence TCCTGATATCTGTGGCTGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 440
Summary {0: 59, 1: 58, 2: 80, 3: 64, 4: 179}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201648874_1201648876 1 Left 1201648874 Y:16264100-16264122 CCAGGGCTCACTTTTGGAGCTTT 0: 53
1: 46
2: 100
3: 45
4: 191
Right 1201648876 Y:16264124-16264146 TCCTGATATCTGTGGCTGATTGG 0: 59
1: 58
2: 80
3: 64
4: 179
1201648873_1201648876 2 Left 1201648873 Y:16264099-16264121 CCCAGGGCTCACTTTTGGAGCTT 0: 51
1: 49
2: 101
3: 49
4: 161
Right 1201648876 Y:16264124-16264146 TCCTGATATCTGTGGCTGATTGG 0: 59
1: 58
2: 80
3: 64
4: 179
1201648869_1201648876 19 Left 1201648869 Y:16264082-16264104 CCAGATTTTGTTCAGGTCCCAGG No data
Right 1201648876 Y:16264124-16264146 TCCTGATATCTGTGGCTGATTGG 0: 59
1: 58
2: 80
3: 64
4: 179
1201648868_1201648876 22 Left 1201648868 Y:16264079-16264101 CCTCCAGATTTTGTTCAGGTCCC No data
Right 1201648876 Y:16264124-16264146 TCCTGATATCTGTGGCTGATTGG 0: 59
1: 58
2: 80
3: 64
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201648876 Original CRISPR TCCTGATATCTGTGGCTGAT TGG Intergenic
900626858 1:3612246-3612268 TCCTCCTGTCTGTGGCTGCTGGG - Intergenic
901028903 1:6294731-6294753 TCCTGTTCCCTGTGGCAGATGGG + Intronic
901411793 1:9089410-9089432 TCTAGATATCTGGGGCAGATTGG - Intergenic
904032759 1:27543410-27543432 ATCTGAGAGCTGTGGCTGATGGG - Intronic
905061491 1:35143450-35143472 TCTTGAACTTTGTGGCTGATGGG + Intergenic
905097400 1:35485545-35485567 TCCACATATCTCTGGCTGATAGG - Intronic
906766727 1:48440774-48440796 TCCTGATATCTGTGACTGATTGG - Intronic
907842391 1:58170424-58170446 TTCTGATATCTGCGGCTGATTGG - Intronic
908300458 1:62757048-62757070 TCCTGATATCTGCGGCTGATTGG - Intergenic
910397402 1:86806373-86806395 TCCTGATATCTGCAGCTGACTGG + Intergenic
911129724 1:94376033-94376055 TCCTGATATCTGCGGCTGATTGG + Intergenic
911299012 1:96150696-96150718 TCCTGATATCTGCAGCTGATTGG - Intergenic
911845571 1:102747316-102747338 TCCTGATATCTGCGGCTGATTGG + Intergenic
912021346 1:105111805-105111827 TCCTGATATCTGCTGCTGATTGG - Intergenic
913305534 1:117427087-117427109 TCCTGATCACTGTGATTGATAGG - Intronic
913382667 1:118228321-118228343 TCCTGATATCTGTGGCTGATTGG - Intergenic
913713549 1:121511337-121511359 TCCCGATGTCTGTGGCTGATTGG - Intergenic
915260609 1:154674275-154674297 TCCTGATATCTGTGGCTGATTGG - Intergenic
916083719 1:161253199-161253221 TCCTGATATGTGTGGCTGATTGG - Intergenic
916114478 1:161475352-161475374 TCCTGATATCTGCAGCTGATTGG - Intergenic
916939572 1:169664797-169664819 TCCTGATATCTGCAGCTGATTGG - Intronic
917086175 1:171307637-171307659 TCCTGATATCTGTGGCTGATTGG - Intergenic
917227618 1:172801179-172801201 TCCTGATATCTGCAGCTGATTGG - Intergenic
917279923 1:173370636-173370658 TCCTGATATCTGTGGCTGATTGG - Intergenic
917281210 1:173379548-173379570 TCCTGATATCTGTGGCTGATTGG - Intergenic
917445748 1:175104730-175104752 TCCTGATATCTGTGGCTGATTGG + Intronic
917676322 1:177322398-177322420 TCCTGATATCTGCAGCTGATTGG - Intergenic
919206326 1:194424780-194424802 TCCTCATATCTGTGGCTGACTGG - Intergenic
919256962 1:195138495-195138517 TCCTGATGTCCGTGGCTGATTGG - Intergenic
919558696 1:199093043-199093065 TCCTGATATCTGCGGCTTATTGG - Intergenic
919643920 1:200073377-200073399 CCTTGATATCTGTGGGGGATTGG + Intronic
921019741 1:211224973-211224995 TCCTGATATCTGTGGCTGATTGG - Intergenic
923350063 1:233095810-233095832 TCCTGACATATGTGGCTCCTTGG - Exonic
1063129012 10:3161587-3161609 CTCTGATTTCTGTGGCTAATGGG - Intronic
1063321657 10:5057453-5057475 TCCTGATATCTGTGGCTGATTGG + Intronic
1063414852 10:5864956-5864978 TCCTGATATCTGTGGCTGATTGG - Intronic
1064603517 10:17016059-17016081 TCCTGATATCTGCAGCTGATTGG + Intronic
1065082465 10:22141575-22141597 TCCTGATATCTGCAGCTGATTGG - Intergenic
1066492679 10:35908654-35908676 TCCAGATATTTGTGGGTGTTTGG - Intergenic
1066614530 10:37281865-37281887 TCCTGATATCTGTGGCTGATTGG + Intronic
1068240697 10:54298253-54298275 TTTTGATATCTGTGGCTGATCGG - Intronic
1068500361 10:57835465-57835487 TCCTGATACCTGCAGCTGATTGG - Intergenic
1071834910 10:89409150-89409172 TCCTGATATCTGTGGCTGATTGG - Intronic
1071970425 10:90900391-90900413 TACTGATATTTGTGTCTGTTGGG + Intronic
1072371608 10:94770592-94770614 TCCTGATATCTGCAGCTGATTGG + Intronic
1072923232 10:99594259-99594281 TCCTATCATCTGTGGGTGATTGG + Intergenic
1073970801 10:109044055-109044077 TCCTGATATCTGTGGCTGATTGG - Intergenic
1074484988 10:113867405-113867427 GCCTGATATCAGTGTTTGATTGG + Intronic
1079731165 11:23938803-23938825 TCCTGATATCTTCAGCTGACTGG + Intergenic
1081033486 11:38114267-38114289 TCCCAATATCTGTGGCTGATTGG - Intergenic
1081146054 11:39563454-39563476 TCCTGATATCTGTGGCTGATTGG - Intergenic
1081421479 11:42877745-42877767 TCCTGATATCTGCAGCTGATTGG - Intergenic
1081685124 11:45036962-45036984 CCCTGACATCCGTAGCTGATTGG + Intergenic
1082906079 11:58309909-58309931 TCCTGATATCTGAGGCTGACTGG + Intergenic
1083001668 11:59297916-59297938 TGCTGATTTCTATGGGTGATAGG - Intergenic
1083035488 11:59633356-59633378 TACTGGTATCTGTAGGTGATGGG - Intergenic
1084211064 11:67622807-67622829 TCCTGATATCTGCAGCTGATTGG - Intergenic
1084688741 11:70712493-70712515 TTCTGAGCTCTGTTGCTGATGGG - Intronic
1085168148 11:74423405-74423427 TCCTGATTTCCTTGGCTCATGGG - Intergenic
1086317449 11:85609270-85609292 TCCTGATATCTGCAGCTGATTGG - Intronic
1087075054 11:94120957-94120979 CCCTGATATCTGCAGCTGATTGG - Intergenic
1087319323 11:96639173-96639195 TCCTGATAGCTGCGGCTGATTGG - Intergenic
1087366703 11:97229001-97229023 TCCTCATATCTGTGAGGGATTGG - Intergenic
1087395972 11:97599254-97599276 TCCTCTTAACTGAGGCTGATAGG - Intergenic
1087458940 11:98422221-98422243 TCCTGATATCTGAGGCTGATTGG + Intergenic
1087683278 11:101237888-101237910 TTCTGATATCTGCAGCTGATTGG + Intergenic
1088087276 11:105996458-105996480 TGCTGAGATCTGTGAGTGATTGG + Intronic
1088492599 11:110402158-110402180 TTCTGATTTCTGCAGCTGATTGG - Intergenic
1088850866 11:113702355-113702377 TCATGAGATCTGTGGCTCTTTGG + Intronic
1090291090 11:125545493-125545515 TGCTGATAGCTGTGGGTGACAGG + Intergenic
1091573856 12:1714397-1714419 TCCTGATATCTGCAGCTGACTGG + Intronic
1092472364 12:8791044-8791066 TCCTGATATCTGAGGCTGATTGG - Intergenic
1092737525 12:11596877-11596899 TCTTGGTATCTGTGGGGGATTGG + Intergenic
1093345304 12:18034058-18034080 TCCTGATATCTGCAGCTGACTGG - Intergenic
1093557857 12:20498618-20498640 TCTTGATATCCATGGCAGATTGG - Intronic
1093580530 12:20780520-20780542 TCCTGATATCTGTGGCTGATTGG + Intergenic
1094319907 12:29172645-29172667 TCCTGATATATGCAGCTGATTGG + Intronic
1094727339 12:33133773-33133795 TGCTGGTATCTGTGGCAGGTGGG - Intergenic
1097428358 12:59473638-59473660 TCCTGATATCTGCAACTGATTGG - Intergenic
1099344653 12:81482776-81482798 ACCTAATAGCTGTAGCTGATGGG + Intronic
1099376309 12:81899208-81899230 TCCTGATATCTGCAGCTGATTGG - Intergenic
1099414687 12:82371686-82371708 TCCTGATATCTGTGGCTGATTGG + Intronic
1099576805 12:84392851-84392873 TCCTGATATCAGTGGCTGATTGG + Intergenic
1099959897 12:89386942-89386964 TCCTGACATCTCTGGCTGCAAGG - Intergenic
1100028429 12:90157079-90157101 TCCTGATGTCTTTGACTAATTGG + Intergenic
1100092206 12:90985383-90985405 TCCTCATATCTGTGGCTGATTGG - Intronic
1100530174 12:95455235-95455257 TCCTGATATCTGTGGCTGATTGG + Intergenic
1101705098 12:107214273-107214295 TTCTGATATCTGCAGCTGATTGG - Intergenic
1104306239 12:127613031-127613053 TCTTGATATCTGTGGATGATTGG - Intergenic
1104767167 12:131337629-131337651 TCCTGATATCTGTGGCTGATTGG - Intergenic
1105477706 13:20742829-20742851 TCCTGGTATCTTTGGCTGGTGGG + Intronic
1105762544 13:23527608-23527630 TCCTGATATCTGTGGCTGATTGG - Intergenic
1106162756 13:27215491-27215513 TCCTCATATCTGTGGCTGATTGG - Intergenic
1106375331 13:29181227-29181249 TGCTGCTACCAGTGGCTGATAGG - Intronic
1107425491 13:40288845-40288867 TCCTGGAATCTCTGGCTGATTGG - Intergenic
1108122966 13:47209504-47209526 TGCTGGTAGCTGTGGCTGTTTGG - Intergenic
1108300586 13:49070855-49070877 TCCTGTTATCTGTGGCAAAATGG - Intronic
1108827068 13:54425277-54425299 TCCTTTCATCTGTGGCTGAAAGG - Intergenic
1108848661 13:54703016-54703038 TCCTGATATCTGTGACTGATTGG - Intergenic
1109424484 13:62152664-62152686 TCCTAATATTTGCAGCTGATTGG - Intergenic
1109501088 13:63236652-63236674 TCCTGATATCTGTGGCTGACTGG - Intergenic
1110280919 13:73693828-73693850 TCCAGCTTTCTGTGGCTGAGGGG - Exonic
1110873939 13:80486643-80486665 TTGTGATATCTTTGGCAGATTGG + Intergenic
1111372585 13:87336265-87336287 TCCTGATATCTGTGGCTGATTGG - Intergenic
1111602001 13:90486282-90486304 TCTTTATATCTGTGGGTCATTGG + Intergenic
1112519182 13:100081048-100081070 TCCTGATACCTGCAGCTGATTGG - Intergenic
1112538436 13:100283567-100283589 TCCTGATATCTGTGGCTGACTGG - Intronic
1112543328 13:100339013-100339035 TCTTGGTATCTGTGGGTGATTGG + Intronic
1113203869 13:107894540-107894562 TCCTGATATCTGCAGCTGATTGG + Intergenic
1113551444 13:111196006-111196028 TCCTGATATCTGCGGCTGATTGG + Intronic
1114339695 14:21730274-21730296 TCCTGGTTTCTGTGGCTTGTGGG - Intergenic
1114574060 14:23696428-23696450 TCCTGAACTTTGTGGCCGATAGG - Intergenic
1115285401 14:31709164-31709186 TCCTGATATCTGTGGCTGATTGG + Intronic
1116089355 14:40285105-40285127 CTTTGATATCTGTGGCTTATGGG - Intergenic
1116412382 14:44640121-44640143 TCCTATTATCTTTGGATGATAGG + Intergenic
1116685066 14:48028624-48028646 TCCTTATATGTTTGGCTGATTGG + Intergenic
1118951503 14:70440028-70440050 GCCTGAGCTCTGTGGCTGGTAGG + Intergenic
1120198850 14:81515758-81515780 TTCTGATATCTGCGGCTGATTGG - Intronic
1121106321 14:91282172-91282194 TCCAGATATCTGTTGCAGGTGGG - Intronic
1121140406 14:91536751-91536773 TCTTGGTATCTGTGGGGGATTGG + Intergenic
1121610632 14:95276382-95276404 TGCTGTCATCTGTGGGTGATAGG + Intronic
1124462026 15:29900896-29900918 TACTCATTTCTGTGGCTGCTGGG - Intronic
1124849753 15:33324891-33324913 TTCTGATCTCAGTGGCTTATAGG + Intronic
1125333984 15:38609586-38609608 TCCTTCTAGCTATGGCTGATTGG + Intergenic
1127851756 15:62919499-62919521 TCCTCCTATCTGTGGCTGATGGG - Intergenic
1128059756 15:64727880-64727902 GCCTGATATCAGTGACTGCTGGG + Intergenic
1130035531 15:80357667-80357689 TCCTGAAATATCTGGGTGATGGG + Intronic
1130438250 15:83924572-83924594 TCTTGATCTCTTTGGCTGATAGG + Intronic
1130735980 15:86549385-86549407 GCTTGACATCTGTGGCTGCTTGG - Intronic
1131411263 15:92210067-92210089 TCCTGATATCTGTGACTGACTGG - Intergenic
1132161507 15:99547319-99547341 TCTTGGCAGCTGTGGCTGATGGG - Intergenic
1135198242 16:20412509-20412531 CCCTTATATCTGTGTCTGTTGGG + Intronic
1135339612 16:21634689-21634711 TCCTGATATCTGCAGCCGATTGG + Intronic
1138015881 16:53428204-53428226 CCCTGGTATCTGTGGGGGATTGG - Intergenic
1138053042 16:53802113-53802135 TCTTGCTATCTGTGGGGGATTGG + Intronic
1139152252 16:64396736-64396758 TCCTGATAACTGTATCAGATGGG + Intergenic
1141519051 16:84565388-84565410 TCCTGAAATCTGAGGCTCAGAGG - Intergenic
1144952546 17:19002021-19002043 TGCTGATGTCTGTGCCTGATGGG - Intronic
1145804162 17:27714582-27714604 TCCTGATATCTTTGGCTGATTGG - Intergenic
1146310565 17:31765244-31765266 TTCTGATATCTGTGGCTAATTGG - Intergenic
1149073957 17:52575940-52575962 TCCTGATATCTGTGGCTCATTGG - Intergenic
1151568066 17:74911120-74911142 TCCTGATATCTGCAGCTGATTGG - Intergenic
1152966137 18:115945-115967 TCGTGGTATCTGTGGCAGATTGG - Intergenic
1153438105 18:5088220-5088242 TCCTGATAGCTGTGGCTGATTGG - Intergenic
1153838471 18:8985296-8985318 CCCTGGTATCTGTGGGGGATTGG - Intergenic
1154927834 18:20956121-20956143 TCGTGGTATCTGTGGCAGATTGG + Intronic
1155556874 18:27029527-27029549 TCTTGGTATCTGTGGCAGATTGG + Intronic
1157857510 18:51116076-51116098 TTCTGATATCTGTGGCTGATTGG + Intergenic
1162107967 19:8382234-8382256 TCCTGATATCTGTGGCTGATTGG - Intronic
1163375053 19:16925005-16925027 GCCTGATGTCTGTGGCTGTTAGG - Intronic
1163516582 19:17767745-17767767 GCCTGTCATCTGTGGCTGTTTGG + Intronic
1164148517 19:22528598-22528620 TCCTGAACTTTGTGGCCGATAGG - Intronic
1164948097 19:32313018-32313040 TCCTGTTATCTGGGGCGGGTAGG + Intergenic
1165658535 19:37554585-37554607 TTCTTAGATCTGTGGCTGATAGG + Intronic
1165847135 19:38825486-38825508 TCCTGATATCTGCGGCTGATTGG - Intronic
1166280655 19:41790629-41790651 TCCCAATTTCTGTGGCTGAAAGG - Intergenic
925949850 2:8899940-8899962 TCCTGATATCTGCGGCTGATTGG + Intronic
926953082 2:18265221-18265243 TCCTTATAGCTGTGGCTGGCAGG - Intronic
928382174 2:30827884-30827906 TGCTGATAGCTGTGGATGACAGG + Intergenic
928617574 2:33055216-33055238 TCCTGATATCTGTGGCTGATTGG + Intronic
929330422 2:40674919-40674941 TTCTGATATTCGTGGCTGATTGG - Intergenic
930038578 2:47103360-47103382 TCCTGATATCTGCGGCTGATTGG - Intronic
930976292 2:57465681-57465703 CCCTGGTATCTGAGGCAGATTGG + Intergenic
931540534 2:63325005-63325027 TCCTGATATCTGCAGCTGATTGG - Intronic
933334238 2:80936286-80936308 TCTTGATATCTGTGAAGGATTGG - Intergenic
933342202 2:81038020-81038042 TCCTGATATCTGTGTCTGATTGG - Intergenic
934867174 2:97823864-97823886 TCCTGTTATCTGTGGCTGATTGG - Intronic
935099850 2:99983076-99983098 TCCAGGTGTCTGTGGCTGATTGG + Intronic
935561433 2:104563834-104563856 TCGTCAGACCTGTGGCTGATTGG + Intergenic
938806139 2:134808640-134808662 TCCTGATATCTGCAGCTGATTGG + Intergenic
939851900 2:147314148-147314170 TTCTGATATCTGTGGTTGATTGG - Intergenic
940736143 2:157454608-157454630 CCTTGATATCTGTGGGGGATTGG + Intronic
940924396 2:159347942-159347964 TCTTGATATCTGTGGGGGATTGG + Intronic
941152408 2:161931187-161931209 TCCTGAGATGATTGGCTGATTGG + Intronic
941207716 2:162594869-162594891 TCTTGGTATCTGTGGGGGATTGG - Intronic
941243462 2:163069521-163069543 TCCTGATATCTGTGGCTGATTGG - Intergenic
944729045 2:202499678-202499700 TCCTGGTATCTGTGGCTGATTGG - Intronic
945769747 2:214028325-214028347 TCCTGAGTTCTGTGGCTTTTAGG - Intronic
946016134 2:216605632-216605654 TCCAGGTAGCTGTGGCTGATTGG + Intergenic
946207318 2:218119171-218119193 TCCTGATATCTGCAGCTGATTGG + Intergenic
946670016 2:222092471-222092493 TCCTGCTCTATGTGGCTGCTTGG - Intergenic
1168733044 20:103827-103849 AGCTGAGATCTGTGGCTGACAGG + Intergenic
1171261550 20:23738689-23738711 TCCTGATGTCTGCAGCTGATTGG - Intergenic
1171270692 20:23814580-23814602 TCCTGATGTCTGCAGCTGATTGG - Intergenic
1172340694 20:34155195-34155217 TCTTGATATCTGTGGCTGATTGG - Intergenic
1173267174 20:41494936-41494958 TCCTTATAACTGTTGCTCATTGG + Intronic
1177135114 21:17299545-17299567 TCCTGATATCTGCAGCTGATTGG - Intergenic
1181953314 22:26570509-26570531 TCCTGATACCTGTGCCAGAATGG - Intronic
949448936 3:4164786-4164808 TCCTGATATCTGTGCCAGATTGG + Intronic
949747373 3:7310678-7310700 TCCTGCTATTTGTGGCAGAGTGG + Intronic
951020531 3:17777233-17777255 TCCTGATATCTGTGGCTGATTGG - Intronic
951239513 3:20272447-20272469 TCTTGATATCTGCAGCTGATTGG - Intergenic
952033175 3:29169299-29169321 TCCTTATGTCTTTGGCCGATGGG + Intergenic
952453070 3:33449409-33449431 TCCTGATATCTGTGGCTGATTGG - Intergenic
952555004 3:34521539-34521561 TACTGATATCTGTGGCTGATTGG + Intergenic
952573342 3:34744204-34744226 CCCTGATATCTGTGGCTTGGGGG + Intergenic
952940904 3:38443687-38443709 TCCTGATATCTGTGACTGATTGG + Intergenic
953622895 3:44548155-44548177 TCCTGACATCTGGGGCTGACTGG + Intergenic
953756663 3:45652372-45652394 TTCTAATATCTGTGTCTGATCGG + Intronic
954232225 3:49226309-49226331 TCCTGATATCTGCAACTGATTGG + Intronic
954577420 3:51684277-51684299 TCCTGGTATCTGGGGCTGCATGG + Intronic
954587021 3:51745094-51745116 TCCTGATATCTGCAGCTGACTGG - Intergenic
955104377 3:55882767-55882789 CCTTGGTATCTGTGGGTGATTGG - Intronic
955375330 3:58390539-58390561 TCCTGATATGTCTGACTAATGGG + Intronic
956246741 3:67192014-67192036 CCCTGGTATCTGTGGGGGATTGG - Intergenic
956842916 3:73156736-73156758 TCCTGATATCTGTGGCTGATTGG + Intergenic
956845127 3:73175519-73175541 GGCTGATATCTATGGCTGACAGG + Intergenic
958601427 3:96300550-96300572 TCCTGATATCTGCGGCTGATTGG - Intergenic
960063731 3:113349290-113349312 TCCTGATACCTGTGGCTGACTGG - Intronic
960804918 3:121574447-121574469 TGCTCCCATCTGTGGCTGATGGG + Intronic
961236634 3:125373787-125373809 TCCATAAATCTGTGGCTGGTGGG - Intronic
961261708 3:125607131-125607153 TCCTGGTATCTGCGGCTGATTGG - Intergenic
961616163 3:128182860-128182882 CCCCGATCTCTGTGGCTGGTGGG - Intronic
961919757 3:130413597-130413619 TCCTGTTCTCTGTGGTTGATGGG + Intronic
963021292 3:140875114-140875136 TCCTGATATCCACAGCTGATTGG - Intergenic
963409180 3:144907096-144907118 TTCTGATCTCTATGGCTAATTGG + Intergenic
963476034 3:145805686-145805708 TCCTGGTATGTGTGACGGATTGG + Intergenic
963696792 3:148573603-148573625 TCCTGATATCTGTGGCTGATTGG - Intergenic
963992252 3:151668171-151668193 TCCTGATATCTGTGGCTGATTGG + Intergenic
964972271 3:162577290-162577312 TCCTGATATTTGCGGCTGATTGG - Intergenic
965062786 3:163804353-163804375 TCCTGATATCTGTGGCTGACTGG - Intergenic
967499339 3:190178837-190178859 TTGTAATATCTGTGTCTGATGGG + Intergenic
967583651 3:191188207-191188229 TCCTGATATCTGCAGCTGATTGG - Intergenic
967885308 3:194329663-194329685 TCCTGATCTCTGGGGCTCAGGGG + Intergenic
967999731 3:195196515-195196537 CCCTGAGATCTGTTGCTGAAAGG - Intronic
968183186 3:196612408-196612430 TCCTGGTGTCTGAGGCTGAAAGG + Intergenic
969022771 4:4148821-4148843 TCCTGATATCTGTGGGGGAGAGG - Intergenic
971281169 4:25243611-25243633 TCCTGATATCTGTGGCTGATTGG + Intronic
971578508 4:28305783-28305805 TCCTGATATCTGTGGCTGATTGG - Intergenic
972133258 4:35862379-35862401 TCCTGATATCTGTGGCTGATTGG + Intergenic
973045897 4:45534223-45534245 TCCTGATATCTGTGGCTGATAGG - Intergenic
974069866 4:57113824-57113846 TCCTGTGATCTTTGGCTGAAGGG + Intergenic
974187352 4:58460867-58460889 TCCTGATATCTGTGGCTGATTGG - Intergenic
974429942 4:61783184-61783206 TCTTGATATCAGTGGCTTAAGGG + Intronic
974526587 4:63055620-63055642 TCCTGATATATGTGGCTGATTGG - Intergenic
974537172 4:63187406-63187428 TCCTGATATCTGTGGCTGACTGG - Intergenic
974838825 4:67279530-67279552 TCCTGATATCTGTGGCTGATTGG + Intergenic
974868170 4:67605254-67605276 TCCTGATTTCTCTGGCTGGAAGG + Intronic
974976644 4:68901808-68901830 TTCTGAGCTCTGTGGCTGGTAGG + Intergenic
975048029 4:69827612-69827634 TCTTGATATCTGTGGCTGACTGG - Intronic
975151349 4:71024964-71024986 TTCTGATATCTTTGGATGAAAGG + Intronic
975595798 4:76047412-76047434 TCCTGATATCTGCGGCTGATTGG + Intronic
975823682 4:78297309-78297331 TCCTCTTTTCTGTGGCTGTTTGG - Intronic
976174280 4:82336268-82336290 TCCTGATATCTGCGGCTGATTGG + Intergenic
977575698 4:98671812-98671834 TCCTGATATTTGTGTCTGTGAGG - Intergenic
977834891 4:101635501-101635523 TTCTGATATCTGCATCTGATTGG + Intronic
977884124 4:102238074-102238096 TCCTGATATCTGCAGCTGATTGG - Intergenic
978124581 4:105120600-105120622 GCCTGAGATCTTTGGCTGCTTGG + Intergenic
978747207 4:112208216-112208238 TCCTGATATCTGTGGCTGATTGG - Intergenic
981079675 4:140626726-140626748 TCCTGCTCTCTGTGGATGATAGG - Intronic
982701160 4:158660756-158660778 TTCTGATATCTGCTGCTGATTGG - Intergenic
982864081 4:160488617-160488639 TGCTGATGGCTGTGGGTGATAGG + Intergenic
982877328 4:160665126-160665148 TCCTGATGTCTGTGGCTCATTGG - Intergenic
983834899 4:172374397-172374419 TCCTGATATCTGCAGCTGATTGG + Intronic
984917485 4:184737210-184737232 TCCTGATATCTGCAACTGATTGG - Intergenic
985635092 5:1031972-1031994 TCCTAAAATCTGAGGCTGAGTGG + Intronic
986933343 5:12854240-12854262 TCCTGATATCTGCAGCTGATTGG - Intergenic
987545203 5:19304546-19304568 TCCTGATATCTGCAGCTGATTGG + Intergenic
987875437 5:23675021-23675043 TCCTGATATCTGTGTGTGTCTGG - Intergenic
987929922 5:24389933-24389955 TTCTGATATGTGTGGCTGATTGG - Intergenic
988357830 5:30200381-30200403 TCCTGATATCTGTGGCTGATTGG - Intergenic
988591983 5:32557087-32557109 TCCTGATATCTGTGGCTGATTGG + Intronic
988605468 5:32675208-32675230 TCCTGATATCTGTGGCTGATTGG + Intergenic
989957381 5:50373112-50373134 TCCTGATATCTGCGGCTTATTGG - Intergenic
989964333 5:50450814-50450836 TCCTGATATCTGCGGCTGATTGG + Intergenic
990116764 5:52400072-52400094 TTCTGATATCTGTGGCTGATTGG - Intergenic
990367835 5:55088400-55088422 TCCTGATATCTGTGACTGACTGG + Intergenic
992049392 5:72929084-72929106 CCCTGATATCTGCAGCTGACTGG - Intergenic
992455230 5:76910273-76910295 TCCTGATATCTGCTGCAGATTGG - Intronic
992542586 5:77779420-77779442 CCCTGATATCTGTGGGGTATTGG - Intronic
993735729 5:91475410-91475432 ACCTAATTTCTGTGGCTGACAGG - Intergenic
994231702 5:97315500-97315522 TCCTGATATCTGCAGCTGATTGG + Intergenic
995583392 5:113623029-113623051 TCCTGATGTCTGTGGCTGATTGG + Intergenic
995706463 5:114993161-114993183 TCCTGACATCTGTGGCTGATTGG - Intergenic
996022187 5:118603618-118603640 TCCTAATTTCTGTGTTTGATGGG + Intergenic
996099199 5:119430072-119430094 TCCTGATATCTGTGGCTGATTGG + Intergenic
996362456 5:122665028-122665050 TCTTGGTATCTGTGGGAGATTGG - Intergenic
997072427 5:130636370-130636392 TCCTGATATCTGCAGCTGATTGG - Intergenic
998111488 5:139506103-139506125 TCCTGATATCTGTGGCTGATTGG - Intergenic
999398771 5:151248572-151248594 GTCTGATATCTGGGGCAGATTGG + Intronic
999911695 5:156209105-156209127 TCCTGGAATCTGTGGCTGTGGGG - Intronic
1000085256 5:157882797-157882819 TCCTGATATCTGTGACTGATTGG - Intergenic
1000879942 5:166685722-166685744 TCCTGATATGTGTGCATCATGGG + Intergenic
1001971243 5:175956582-175956604 TCCTGTTAACTGAGGCTGCTGGG - Intronic
1002246199 5:177887195-177887217 TCCTGTTAACTGAGGCTGCTGGG + Intergenic
1003252464 6:4442326-4442348 TCTTGATGTCTGTGGATGAAAGG + Intergenic
1003805812 6:9725075-9725097 TCCTGGTATCTGCAGCTGATCGG - Intronic
1004603399 6:17172406-17172428 TCCTGATATGTGAGGGTGTTTGG + Intergenic
1004998726 6:21219165-21219187 TCTTGGTATCTGTGGGGGATTGG + Intronic
1005544952 6:26857366-26857388 TCATGATATCTGTGGTAGGTAGG - Intergenic
1006221809 6:32497803-32497825 TCCTGATTCCTGTGGCTAATTGG - Intergenic
1006611806 6:35298524-35298546 ACCTGATATGTGTGGTGGATAGG - Intronic
1007030062 6:38619191-38619213 TCCTGATATCCGTGGCTGACTGG - Intronic
1007740504 6:44006682-44006704 TCCTGTCATCAGTGTCTGATGGG - Intergenic
1008294053 6:49755532-49755554 TTCTCATATCTGTGTATGATGGG + Intergenic
1009015739 6:57898987-57899009 TCATGATATCTGTGGTAGGTAGG - Intergenic
1009385912 6:63084019-63084041 TCCTGATATCTGTGGCTGACTGG + Intergenic
1009470828 6:64027402-64027424 TCCTGATATCTGTGGCTGATTGG - Intronic
1009872804 6:69470914-69470936 TCCTGATATCTGTGGCTCATTGG - Intergenic
1009933841 6:70208655-70208677 TCCTGATTGCTGTGGCTGGCAGG - Exonic
1010269844 6:73906571-73906593 TCCTGATATCTGCAGCTGATTGG - Intergenic
1010471444 6:76233168-76233190 TTTTTATTTCTGTGGCTGATAGG + Intergenic
1011375020 6:86678609-86678631 TCCTGATATCTGTGGCTGATTGG + Intergenic
1012441531 6:99266035-99266057 TCCTGATATCTGCAGCTGATTGG + Intergenic
1012592316 6:100997376-100997398 TCCTGATTTCTGTTAGTGATAGG + Intergenic
1013907825 6:115238369-115238391 TACTGATATCTGCTGCTGATTGG + Intergenic
1013977446 6:116093861-116093883 TCCTGATATCTGTGGCTGATTGG - Intergenic
1016184055 6:141178941-141178963 TCCTGATATCTGCAGCTGATTGG - Intergenic
1017721060 6:157243495-157243517 TCCTGGTTTCTTTGGCTCATGGG + Intergenic
1019543064 7:1560154-1560176 CCCTGGGATCTGGGGCTGATGGG - Intronic
1020411001 7:7891393-7891415 TCCTGATATCAGTTGATGAATGG + Intronic
1021356561 7:19658264-19658286 TCCTGATAACTGTTGCTGATTGG + Intergenic
1021418963 7:20423167-20423189 TCTTGGTATCTGTGGGAGATTGG + Intergenic
1021756708 7:23859320-23859342 TCCTGATGTCTGCGGCTGATTGG + Intergenic
1022670797 7:32453625-32453647 TCCTGAGATATGTGGCTAAGTGG - Intergenic
1023077939 7:36501984-36502006 TCCTGATATCTGTGGCTAATTGG + Intergenic
1023219272 7:37901971-37901993 TCCTCATGTATTTGGCTGATGGG - Intronic
1023432259 7:40106880-40106902 CCCTGGTATCTGTGGGAGATTGG + Intergenic
1023606625 7:41937191-41937213 TCATGATATCTGACTCTGATGGG + Intergenic
1024870765 7:53959933-53959955 TCCTGATATCTGCGGCTGATTGG + Intergenic
1027459958 7:78439859-78439881 TCATAATCTCTGTGGCTGCTTGG + Intronic
1027791139 7:82639856-82639878 TCCTGATATCTGCAGCTGATTGG - Intergenic
1028495206 7:91453547-91453569 TCCTGATATCTGCAGCTAATTGG + Intergenic
1030420534 7:109301975-109301997 TCCTGATATCTGCAGCTGATTGG - Intergenic
1031482359 7:122293919-122293941 TCCTGACATCTTTGTCAGATTGG + Intergenic
1031731798 7:125310601-125310623 TCCTGATATCCGCTGCTGATTGG - Intergenic
1031893946 7:127326424-127326446 TCCTGAGAGCTGAAGCTGATGGG + Intergenic
1033109261 7:138560204-138560226 TCCTGAACTCTGTGGCTTATAGG + Intronic
1033759229 7:144422147-144422169 TCCTGATATCTGCAGCTGATTGG + Intergenic
1034579961 7:152033503-152033525 TCCTGATATCCACGGCTGATTGG + Intronic
1035080812 7:156214479-156214501 ACCTGAAATCTGTGCCTAATTGG + Intergenic
1038430764 8:27497614-27497636 TCCTGATATCTGCGGCTGATTGG + Intronic
1038638805 8:29307758-29307780 TCCTGATATCTGCGGCTGATTGG - Intergenic
1038747033 8:30263506-30263528 TCCTGATATGTGTGCCTGAGAGG - Intergenic
1039055553 8:33533509-33533531 TCCTGATATTTGTGTGTGTTGGG - Intergenic
1039276025 8:35934783-35934805 TCCTGATATCTGTGGCTGATTGG - Intergenic
1039693159 8:39882716-39882738 TTCTGTTATCTGCAGCTGATTGG + Intergenic
1039999663 8:42565378-42565400 TCCTGTTATCTGCAGCTGAATGG + Intergenic
1040648971 8:49429105-49429127 TCCTGATATCTGCAGCTGATTGG - Intergenic
1040667852 8:49654225-49654247 TCCTGGTATCTGCAGCTGATTGG + Intergenic
1040965042 8:53074315-53074337 TCCTGATATTTGTGGTTGATTGG + Intergenic
1040971438 8:53140800-53140822 TCCTGATATCTGCAGCTGATTGG + Intergenic
1040999917 8:53440082-53440104 TCCTGATATCTGTGGCTGATTGG + Intergenic
1041001923 8:53462361-53462383 TCCTGATTTCTGTGGCTGATTGG - Intergenic
1041278596 8:56189331-56189353 TCCTGATATCTGTAGAGGGTGGG - Intronic
1042697722 8:71575220-71575242 TCCTGATAAGTGTGGCTAATAGG + Intronic
1042771931 8:72390731-72390753 TCCTGATATCTGCGGTTGATTGG - Intergenic
1042919629 8:73908793-73908815 TCCTGATATCTGTGGTTGATTGG - Intergenic
1043257073 8:78150355-78150377 TCCTGATATCTGCAGCTTATTGG - Intergenic
1044456615 8:92398112-92398134 TCCTGATATCTGCGGCTGATTGG + Intergenic
1045858567 8:106791337-106791359 TCCTGATATCTGCAGCTGATTGG - Intergenic
1046157918 8:110318155-110318177 TCTTGGTATCTGTGGGGGATTGG - Intergenic
1048904336 8:139073450-139073472 TCCTGATATGTGGGGATTATGGG - Intergenic
1049895058 9:105458-105480 TCCCGATATCTGTGGGGGAGAGG + Intergenic
1050751714 9:8946521-8946543 TCTTGGTAGCTGTAGCTGATGGG + Intronic
1051402337 9:16696480-16696502 TCCTGATACCTTTGGATGAAAGG + Intronic
1052057758 9:23923094-23923116 TCCTGATATCTGCAGCTGATTGG + Intergenic
1052289506 9:26826134-26826156 TCCTGATATCTGCGGTTGATTGG - Intergenic
1052663794 9:31469338-31469360 TGCTGATGTCTGTGGGTGACAGG - Intergenic
1053004515 9:34595371-34595393 CCTTGATATCTGTGGGGGATTGG + Intergenic
1053737464 9:41110597-41110619 TCCCGATATCTGTGGGGGAGAGG + Intergenic
1054690885 9:68320722-68320744 TCCCGATATCTGTGGGGGAGAGG - Intergenic
1055458260 9:76492965-76492987 TCCTGACATCTGCAGCTGATTGG + Intronic
1056110993 9:83394663-83394685 TCCTGACATCTGTGTTTGGTGGG - Intronic
1056392767 9:86154498-86154520 TCCTGATATCTGTGGCTGATTGG + Intergenic
1058355986 9:104083922-104083944 TGCTGATGTCTGTGGGTGACAGG - Intergenic
1058472271 9:105292365-105292387 TCCTCATTTCTGAGGCTGAAAGG + Intronic
1059253656 9:112909565-112909587 TACTGGTCTCTGGGGCTGATAGG - Intergenic
1059435139 9:114271551-114271573 TCCTGACATTTGTGGCTGACAGG - Intronic
1185783515 X:2869370-2869392 TCCTGATATCCATGGAGGATTGG - Intronic
1186628918 X:11326945-11326967 TCATGAAATCAGTGGATGATTGG - Intronic
1186781050 X:12912410-12912432 TTCTGAGATCAGTGGCTGCTGGG + Intronic
1188097537 X:26042892-26042914 TCCTGATATCTGTGGCTGATTGG - Intergenic
1188136532 X:26500249-26500271 TCCTGATATCTGTGGCTGATTGG - Intergenic
1189613801 X:42764580-42764602 TCCGGATATCTGGGGAGGATTGG - Intergenic
1189743007 X:44141143-44141165 CCTTGATATCTGTGGACGATTGG + Intergenic
1190072664 X:47291828-47291850 TCCAGATATCTGGGGCAGATTGG + Intergenic
1190541478 X:51482397-51482419 TCCTGATATCCACGGCTGATTGG - Intergenic
1190740508 X:53285338-53285360 TGCTGCTAAATGTGGCTGATAGG - Intronic
1191604163 X:63043345-63043367 TTCTAATATCTTGGGCTGATTGG + Intergenic
1191823317 X:65336871-65336893 TGCTGATGTCTGTGGATGACAGG - Intergenic
1192189576 X:68982788-68982810 TTCTGATGACTCTGGCTGATGGG - Intergenic
1192482745 X:71499415-71499437 TCCTGATATCTGCAGCTGATTGG + Intronic
1192573205 X:72223005-72223027 TCTGGATATCTGGGGCAGATTGG - Intronic
1192609502 X:72553619-72553641 CCTTGATATCTGTGGGTGATTGG + Intronic
1192869998 X:75175974-75175996 TCCTGATATCTGCGGCTGATTGG + Intergenic
1194023682 X:88725081-88725103 TGCTGATATCTTTGTCTGTTTGG - Intergenic
1194176569 X:90656543-90656565 TCCTGCTATATGTGGCAGAATGG - Intergenic
1195439584 X:104885530-104885552 TCCTGATATCTGCGGCTGATTGG - Intronic
1195552370 X:106184237-106184259 TCCTGATACCTGGGGCTGATTGG + Intronic
1196127335 X:112114018-112114040 TCCTGATATCTGTGGCTGATTGG + Intergenic
1196419368 X:115506856-115506878 TCCTGATATCTGTGGCTGATTGG + Intergenic
1196488999 X:116246279-116246301 TCCTGATATCTGTGGCTGATTGG - Intergenic
1196768619 X:119272058-119272080 TCCTGATGTGTGTGGCAGCTGGG + Intergenic
1197329540 X:125136915-125136937 TCTTGATATCTGTGGGGGATTGG - Intergenic
1197442141 X:126505032-126505054 TCCTAATTTCTTTGGCTGTTTGG + Intergenic
1197513421 X:127397790-127397812 TCCTGATATCCGTGGCTGATTGG - Intergenic
1198339387 X:135699381-135699403 TCCTGATATCTGGGGTAGACTGG - Intergenic
1198691898 X:139293630-139293652 TCCTGTTACCTGTGGCAGTTAGG + Intergenic
1199372024 X:147060674-147060696 ACCTGTTAGCTGTGGGTGATAGG - Intergenic
1200694962 Y:6350659-6350681 TCTTGATATCTTCAGCTGATTGG + Intergenic
1200711287 Y:6487071-6487093 TCCTGATATCTGCAGCTGATTGG - Intergenic
1200776228 Y:7172566-7172588 TTCTGATATCTCTGGCTGATTGG - Intergenic
1200880790 Y:8209633-8209655 TCCCAATATCTGTGGTGGATTGG + Intergenic
1200945334 Y:8830104-8830126 TCCTGATATCTGTGGCTGATTGG - Intergenic
1200959321 Y:8982645-8982667 TACTGATATCTGGGTCTGATTGG - Intergenic
1200966779 Y:9046063-9046085 TCCTGATATCTGTGGCTGATTGG - Intergenic
1201022647 Y:9674915-9674937 TCCTGATATCTGCAGCTGATTGG + Intergenic
1201040315 Y:9824051-9824073 TCTTGATATCTTCAGCTGATTGG - Intergenic
1201271927 Y:12263927-12263949 TCCTCATATCTGCAGCTGATTGG + Intergenic
1201403773 Y:13630587-13630609 TCCTGGTATCTGTTGCTGATTGG - Intergenic
1201407499 Y:13663575-13663597 TCCTGATATCTGCAGCTGATTGG + Intergenic
1201429707 Y:13891727-13891749 TCCTGATATCTGCAGCTGATTGG - Intergenic
1201473156 Y:14355157-14355179 TCCTGATATCTGCAGCTGACTGG + Intergenic
1201487593 Y:14509096-14509118 TCCTGATATCTGCAGTTGATTGG - Intergenic
1201515963 Y:14818943-14818965 TCCTGATATCTGCAGCTGATTGG + Intronic
1201530560 Y:14986235-14986257 TCCTGACATCTTTGGCTGATTGG - Intergenic
1201555746 Y:15263497-15263519 TTCTGATATCTGTGGCTGATTGG - Intergenic
1201568572 Y:15391048-15391070 TCCTGATATCTGTGGCTCACTGG + Intergenic
1201631269 Y:16074034-16074056 TCCTGATATCTGCAGCTGATTGG - Intergenic
1201648876 Y:16264124-16264146 TCCTGATATCTGTGGCTGATTGG + Intergenic
1201653933 Y:16321176-16321198 TCCTGATATCTGTGGCTGATTGG - Intergenic
1201729587 Y:17189860-17189882 TCTTGATATCTGCAGCTGATTGG + Intergenic
1201908212 Y:19106441-19106463 TCCTGATGTCTGTTACTGATTGG + Intergenic
1201911107 Y:19134322-19134344 TCCTGATAGCTGTGCCTGATTGG - Intergenic
1201989503 Y:20008708-20008730 TCTTGATATCTGCAGCTGATTGG + Intergenic
1202074692 Y:21026333-21026355 TCCTGATATCCACAGCTGATTGG + Intergenic
1202089867 Y:21178243-21178265 TTCTCATATCTGCAGCTGATTGG + Intergenic
1202146679 Y:21806109-21806131 TCCTGATATCTGTGGCTGATTGG + Intergenic
1202192596 Y:22260125-22260147 TCCTGATATCTGCTGCTGATTGG + Intergenic
1202242896 Y:22788928-22788950 TCCTGATATCTGTGGCTGATTGG - Intergenic
1202257836 Y:22939787-22939809 TCCTGATGTCTGTGGCTGATTGG - Intergenic
1202272044 Y:23082150-23082172 TCCTGATAGCTGTGGCTGATTGG + Intergenic
1202293982 Y:23338532-23338554 TCCTGATAGCTGTGGCTGATTGG - Intergenic
1202395883 Y:24422678-24422700 TCCTGATATCTGTGGCTGATTGG - Intergenic
1202410826 Y:24573534-24573556 TCCTGATGTCTGTGGCTGATTGG - Intergenic
1202425041 Y:24715894-24715916 TCCTGATAGCTGTGGCTGATTGG + Intergenic
1202445748 Y:24954191-24954213 TCCTGATAGCTGTGGCTGATTGG - Intergenic
1202459955 Y:25096538-25096560 TCCTGATGTCTGTGGCTGATTGG + Intergenic
1202474902 Y:25247414-25247436 TCCTGATATCTGTGGCTGATTGG + Intergenic