ID: 1201650538

View in Genome Browser
Species Human (GRCh38)
Location Y:16280004-16280026
Sequence AAATGGGAATGGAGGGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201650538_1201650546 21 Left 1201650538 Y:16280004-16280026 CCTCCTTCCCTCCATTCCCATTT No data
Right 1201650546 Y:16280048-16280070 CTGCTCAAGCTGGAGTAGACTGG No data
1201650538_1201650545 11 Left 1201650538 Y:16280004-16280026 CCTCCTTCCCTCCATTCCCATTT No data
Right 1201650545 Y:16280038-16280060 TCTTGCATTGCTGCTCAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201650538 Original CRISPR AAATGGGAATGGAGGGAAGG AGG (reversed) Intergenic
No off target data available for this crispr