ID: 1201650997

View in Genome Browser
Species Human (GRCh38)
Location Y:16286390-16286412
Sequence CAGAACATGCAGCATTTAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201650997_1201650998 7 Left 1201650997 Y:16286390-16286412 CCTGTTAAATGCTGCATGTTCTG No data
Right 1201650998 Y:16286420-16286442 TCTTTAACAGTCTTACATTGTGG No data
1201650997_1201650999 20 Left 1201650997 Y:16286390-16286412 CCTGTTAAATGCTGCATGTTCTG No data
Right 1201650999 Y:16286433-16286455 TACATTGTGGCTTTTCTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201650997 Original CRISPR CAGAACATGCAGCATTTAAC AGG (reversed) Intergenic
No off target data available for this crispr