ID: 1201653931

View in Genome Browser
Species Human (GRCh38)
Location Y:16321175-16321197
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 404
Summary {0: 56, 1: 61, 2: 80, 3: 50, 4: 157}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201653931_1201653935 2 Left 1201653931 Y:16321175-16321197 CCCAATCAGCCACAGATATCAGG 0: 56
1: 61
2: 80
3: 50
4: 157
Right 1201653935 Y:16321200-16321222 AAAGCTCCAAAAGTGAGCCCTGG 0: 53
1: 46
2: 100
3: 45
4: 191
1201653931_1201653940 20 Left 1201653931 Y:16321175-16321197 CCCAATCAGCCACAGATATCAGG 0: 56
1: 61
2: 80
3: 50
4: 157
Right 1201653940 Y:16321218-16321240 CCTGGGACCTGAACAAAATCTGG No data
1201653931_1201653936 3 Left 1201653931 Y:16321175-16321197 CCCAATCAGCCACAGATATCAGG 0: 56
1: 61
2: 80
3: 50
4: 157
Right 1201653936 Y:16321201-16321223 AAGCTCCAAAAGTGAGCCCTGGG 0: 51
1: 49
2: 101
3: 49
4: 161
1201653931_1201653941 23 Left 1201653931 Y:16321175-16321197 CCCAATCAGCCACAGATATCAGG 0: 56
1: 61
2: 80
3: 50
4: 157
Right 1201653941 Y:16321221-16321243 GGGACCTGAACAAAATCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201653931 Original CRISPR CCTGATATCTGTGGCTGATT GGG (reversed) Intergenic
901387841 1:8922823-8922845 CCAAATGTCTGGGGCTGATTGGG - Intergenic
901411792 1:9089409-9089431 CTAGATATCTGGGGCAGATTGGG - Intergenic
903193152 1:21668011-21668033 CCTGAGGGCTGTGGCTGAGTGGG - Intronic
903216698 1:21847444-21847466 CCAAATGTCTGTGGCTGACTCGG - Exonic
904365273 1:30007063-30007085 CCTGATCTATGTGGCTAATATGG - Intergenic
905097398 1:35485544-35485566 CCACATATCTCTGGCTGATAGGG - Intronic
905864892 1:41371362-41371384 CCTGATATCTGGGACTCTTTGGG - Intronic
906766725 1:48440773-48440795 CCTGATATCTGTGACTGATTGGG - Intronic
907837496 1:58124716-58124738 CCTGTTATCTGTGTGTGCTTAGG + Intronic
907842390 1:58170423-58170445 TCTGATATCTGCGGCTGATTGGG - Intronic
908300456 1:62757047-62757069 CCTGATATCTGCGGCTGATTGGG - Intergenic
909683424 1:78318942-78318964 CCTGATATGTATGGCAGAATGGG + Intronic
910397404 1:86806374-86806396 CCTGATATCTGCAGCTGACTGGG + Intergenic
910444931 1:87290548-87290570 CCAGAACTGTGTGGCTGATTGGG + Intergenic
911129726 1:94376034-94376056 CCTGATATCTGCGGCTGATTGGG + Intergenic
911299010 1:96150695-96150717 CCTGATATCTGCAGCTGATTGGG - Intergenic
911751457 1:101501654-101501676 TCCTGTATCTGTGGCTGATTGGG - Intergenic
911845573 1:102747317-102747339 CCTGATATCTGCGGCTGATTGGG + Intergenic
912021344 1:105111804-105111826 CCTGATATCTGCTGCTGATTGGG - Intergenic
912338469 1:108886733-108886755 CCTGATGTGTATGTCTGATTTGG - Intronic
912367793 1:109149353-109149375 ACTGATTTCTCTGGATGATTAGG - Intronic
912439170 1:109685679-109685701 CCTGATTTCTGTGGCCTAATAGG + Intronic
912442486 1:109710128-109710150 CCTGATTTCTGTGGCCTAATAGG + Intergenic
913094317 1:115502174-115502196 CCTGTTATTTATGGCTGATACGG + Intergenic
913382665 1:118228320-118228342 CCTGATATCTGTGGCTGATTGGG - Intergenic
913713547 1:121511336-121511358 CCCGATGTCTGTGGCTGATTGGG - Intergenic
915260607 1:154674274-154674296 CCTGATATCTGTGGCTGATTGGG - Intergenic
916083717 1:161253198-161253220 CCTGATATGTGTGGCTGATTGGG - Intergenic
916114476 1:161475351-161475373 CCTGATATCTGCAGCTGATTGGG - Intergenic
916939570 1:169664796-169664818 CCTGATATCTGCAGCTGATTGGG - Intronic
917086173 1:171307636-171307658 CCTGATATCTGTGGCTGATTGGG - Intergenic
917103343 1:171467812-171467834 CCAGCTATCTGTGGCTGAGGTGG - Intergenic
917227616 1:172801178-172801200 CCTGATATCTGCAGCTGATTGGG - Intergenic
917279921 1:173370635-173370657 CCTGATATCTGTGGCTGATTGGG - Intergenic
917281208 1:173379547-173379569 CCTGATATCTGTGGCTGATTGGG - Intergenic
917445750 1:175104731-175104753 CCTGATATCTGTGGCTGATTGGG + Intronic
917676320 1:177322397-177322419 CCTGATATCTGCAGCTGATTGGG - Intergenic
919206324 1:194424779-194424801 CCTCATATCTGTGGCTGACTGGG - Intergenic
919256960 1:195138494-195138516 CCTGATGTCCGTGGCTGATTGGG - Intergenic
919558694 1:199093042-199093064 CCTGATATCTGCGGCTTATTGGG - Intergenic
919615259 1:199799343-199799365 TCTAATTTCTGTGGCTGATCTGG - Intergenic
919796150 1:201322688-201322710 CCAGATATGTGGGGCTGCTTTGG - Intronic
919838551 1:201593104-201593126 TTTGATATCTGGGGCTGAGTAGG + Intergenic
921019739 1:211224972-211224994 CCTGATATCTGTGGCTGATTGGG - Intergenic
1063129011 10:3161586-3161608 TCTGATTTCTGTGGCTAATGGGG - Intronic
1063321659 10:5057454-5057476 CCTGATATCTGTGGCTGATTGGG + Intronic
1064603519 10:17016060-17016082 CCTGATATCTGCAGCTGATTGGG + Intronic
1065029108 10:21567367-21567389 CCTGATCTCTGTGGTGGATGTGG + Intronic
1065082463 10:22141574-22141596 CCTGATATCTGCAGCTGATTGGG - Intergenic
1065754973 10:28922795-28922817 CCTGGATTCTGTGGCTGATGTGG + Intergenic
1066314445 10:34230212-34230234 CCTGATTTCTGTGGCTGGGTAGG - Intronic
1066614532 10:37281866-37281888 CCTGATATCTGTGGCTGATTGGG + Intronic
1068240696 10:54298252-54298274 TTTGATATCTGTGGCTGATCGGG - Intronic
1068500359 10:57835464-57835486 CCTGATACCTGCAGCTGATTGGG - Intergenic
1068762716 10:60731558-60731580 CCAGATATTAGTAGCTGATTTGG + Intronic
1069365039 10:67687653-67687675 CCTGATATCTGTGGCTGATTAGG + Intronic
1070068777 10:73065246-73065268 CATGATATCTTTGGCAGATATGG + Intronic
1070775742 10:79108761-79108783 CCTGATTTATGGGGCTGTTTTGG + Intronic
1071359916 10:84836355-84836377 CCTTATATCTATGGCAGATTTGG + Intergenic
1071834908 10:89409149-89409171 CCTGATATCTGTGGCTGATTGGG - Intronic
1072191670 10:93081168-93081190 CTTGATCTCTGTGGCGGCTTAGG - Intergenic
1072371610 10:94770593-94770615 CCTGATATCTGCAGCTGATTGGG + Intronic
1073970799 10:109044054-109044076 CCTGATATCTGTGGCTGATTGGG - Intergenic
1074152531 10:110770150-110770172 CCTCATCTCTGTGTCTGACTCGG - Intronic
1075418947 10:122286651-122286673 TCTGATATCTGTGGCTTGTTTGG + Intronic
1079731167 11:23938804-23938826 CCTGATATCTTCAGCTGACTGGG + Intergenic
1081033484 11:38114266-38114288 CCCAATATCTGTGGCTGATTGGG - Intergenic
1081146052 11:39563453-39563475 CCTGATATCTGTGGCTGATTGGG - Intergenic
1081421477 11:42877744-42877766 CCTGATATCTGCAGCTGATTGGG - Intergenic
1082906081 11:58309910-58309932 CCTGATATCTGAGGCTGACTGGG + Intergenic
1083958220 11:65998702-65998724 CCTGATAACTGTGGCTCAGCTGG + Exonic
1084211062 11:67622806-67622828 CCTGATATCTGCAGCTGATTGGG - Intergenic
1085158315 11:74317125-74317147 TCTGATATCTTTGTCTGTTTTGG + Intergenic
1086317447 11:85609269-85609291 CCTGATATCTGCAGCTGATTGGG - Intronic
1086908190 11:92441269-92441291 ACTTTTATCTGTGGCTGTTTTGG + Intronic
1087075052 11:94120956-94120978 CCTGATATCTGCAGCTGATTGGG - Intergenic
1087319321 11:96639172-96639194 CCTGATAGCTGCGGCTGATTGGG - Intergenic
1087458942 11:98422222-98422244 CCTGATATCTGAGGCTGATTGGG + Intergenic
1087683279 11:101237889-101237911 TCTGATATCTGCAGCTGATTGGG + Intergenic
1088087277 11:105996459-105996481 GCTGAGATCTGTGAGTGATTGGG + Intronic
1088492598 11:110402157-110402179 TCTGATTTCTGCAGCTGATTGGG - Intergenic
1089726159 11:120482261-120482283 CCTATTATCTGTGACTCATTAGG + Intronic
1091255426 11:134180474-134180496 GCTGATTTCAGTGGCTGACTGGG - Intronic
1091573858 12:1714398-1714420 CCTGATATCTGCAGCTGACTGGG + Intronic
1092472362 12:8791043-8791065 CCTGATATCTGAGGCTGATTGGG - Intergenic
1093345302 12:18034057-18034079 CCTGATATCTGCAGCTGACTGGG - Intergenic
1093580532 12:20780521-20780543 CCTGATATCTGTGGCTGATTGGG + Intergenic
1093844370 12:23950679-23950701 CTTGTTATCTGTGGCTGCCTGGG - Intronic
1094319909 12:29172646-29172668 CCTGATATATGCAGCTGATTGGG + Intronic
1095735626 12:45553476-45553498 CCTGAGCTCTTTGGCTGAATGGG + Intergenic
1097428356 12:59473637-59473659 CCTGATATCTGCAACTGATTGGG - Intergenic
1098687062 12:73435002-73435024 TGTGAGATCTGTGACTGATTTGG + Intergenic
1099085701 12:78243786-78243808 CCTGATATTTATGACTGAATAGG - Intergenic
1099376307 12:81899207-81899229 CCTGATATCTGCAGCTGATTGGG - Intergenic
1099414689 12:82371687-82371709 CCTGATATCTGTGGCTGATTGGG + Intronic
1099576807 12:84392852-84392874 CCTGATATCAGTGGCTGATTGGG + Intergenic
1100092204 12:90985382-90985404 CCTCATATCTGTGGCTGATTGGG - Intronic
1100152660 12:91759483-91759505 CTTGATATCTTTTGTTGATTGGG - Intergenic
1100209853 12:92389373-92389395 CCTGATATCTGCAGCAGACTGGG - Intergenic
1100530176 12:95455236-95455258 CCTGATATCTGTGGCTGATTGGG + Intergenic
1101332244 12:103766453-103766475 CCTCATCTCTCTGGCTGATCTGG + Exonic
1101705097 12:107214272-107214294 TCTGATATCTGCAGCTGATTGGG - Intergenic
1101779722 12:107824490-107824512 CCTGATATCTGCGGCTGATTCGG - Intergenic
1104306238 12:127613030-127613052 CTTGATATCTGTGGATGATTGGG - Intergenic
1104767165 12:131337628-131337650 CCTGATATCTGTGGCTGATTGGG - Intergenic
1105762542 13:23527607-23527629 CCTGATATCTGTGGCTGATTGGG - Intergenic
1106162754 13:27215490-27215512 CCTCATATCTGTGGCTGATTGGG - Intergenic
1106621158 13:31372516-31372538 CCTGACTTCTGTAGCTCATTAGG - Intergenic
1108122965 13:47209503-47209525 GCTGGTAGCTGTGGCTGTTTGGG - Intergenic
1108848659 13:54703015-54703037 CCTGATATCTGTGACTGATTGGG - Intergenic
1109424482 13:62152663-62152685 CCTAATATTTGCAGCTGATTGGG - Intergenic
1109501086 13:63236651-63236673 CCTGATATCTGTGGCTGACTGGG - Intergenic
1110102619 13:71628421-71628443 TTAGATATCTGTAGCTGATTTGG - Intronic
1111372583 13:87336264-87336286 CCTGATATCTGTGGCTGATTGGG - Intergenic
1112369945 13:98785533-98785555 CCTGATATCTGCTGCTGGTCCGG - Intergenic
1112519180 13:100081047-100081069 CCTGATACCTGCAGCTGATTGGG - Intergenic
1112538434 13:100283566-100283588 CCTGATATCTGTGGCTGACTGGG - Intronic
1112859890 13:103817663-103817685 CCTGTTCTCTGTGGTTGATGTGG - Intergenic
1113154380 13:107301832-107301854 CCTGACAGCTGTGGTGGATTAGG + Intronic
1113551446 13:111196007-111196029 CCTGATATCTGCGGCTGATTGGG + Intronic
1113987021 13:114325365-114325387 CCAGATATCTGAGGCTGCTTTGG - Exonic
1115285403 14:31709165-31709187 CCTGATATCTGTGGCTGATTGGG + Intronic
1118086629 14:62425314-62425336 ACTCATACCTTTGGCTGATTTGG - Intergenic
1120198849 14:81515757-81515779 TCTGATATCTGCGGCTGATTGGG - Intronic
1122173490 14:99897741-99897763 CCTCATGTTTGTGGCTGAGTCGG + Intronic
1127682208 15:61308921-61308943 CCAGATTTCTGTGGCTGAGTTGG - Intergenic
1131411261 15:92210066-92210088 CCTGATATCTGTGACTGACTGGG - Intergenic
1132202233 15:99962942-99962964 AATGGTATCTGTGGCTGAATTGG + Intergenic
1135339614 16:21634690-21634712 CCTGATATCTGCAGCCGATTGGG + Intronic
1139099162 16:63744509-63744531 CCTGGTAGCTGTGGCTGTGTGGG - Intergenic
1139114357 16:63931490-63931512 GCTCTTATCTGTAGCTGATTTGG - Intergenic
1139154505 16:64424150-64424172 CCTGAGATCTGTGGCTACTCTGG + Intergenic
1139698823 16:68694705-68694727 CTTGAAGTCTGTGGCTAATTAGG + Intronic
1144952545 17:19002020-19002042 GCTGATGTCTGTGCCTGATGGGG - Intronic
1145771994 17:27499925-27499947 CCTGTTATCTGAGGCTGGTCTGG + Intronic
1145804160 17:27714581-27714603 CCTGATATCTTTGGCTGATTGGG - Intergenic
1146310564 17:31765243-31765265 TCTGATATCTGTGGCTAATTGGG - Intergenic
1148226932 17:45905639-45905661 CCTGTTATCACTGGCTGCTTAGG + Intronic
1148595898 17:48855174-48855196 CCTGAGACCTGTGGCTAAGTTGG - Intronic
1149073955 17:52575939-52575961 CCTGATATCTGTGGCTCATTGGG - Intergenic
1149209719 17:54288998-54289020 CCTTATATCTGTGTCTGATTTGG - Intergenic
1151051071 17:70979054-70979076 ACTGATAGTCGTGGCTGATTGGG + Intergenic
1151568064 17:74911119-74911141 CCTGATATCTGCAGCTGATTGGG - Intergenic
1151666679 17:75549362-75549384 CCTGATGGGTGTGGCTGCTTGGG - Intronic
1153438103 18:5088219-5088241 CCTGATAGCTGTGGCTGATTGGG - Intergenic
1157857511 18:51116077-51116099 TCTGATATCTGTGGCTGATTGGG + Intergenic
1160034638 18:75288608-75288630 CCTGATCTATGTGACTGAGTTGG + Exonic
1162237423 19:9320209-9320231 CCTGATATCTGCGGCTGATTTGG + Intergenic
925949852 2:8899941-8899963 CCTGATATCTGCGGCTGATTGGG + Intronic
927929543 2:27035372-27035394 CCTGATTTCCATGGGTGATTTGG + Intronic
928617576 2:33055217-33055239 CCTGATATCTGTGGCTGATTGGG + Intronic
929212342 2:39371063-39371085 CCTGTGGTCTGTGGCTGATCCGG - Intronic
929330421 2:40674918-40674940 TCTGATATTCGTGGCTGATTGGG - Intergenic
930038576 2:47103359-47103381 CCTGATATCTGCGGCTGATTGGG - Intronic
931540532 2:63325004-63325026 CCTGATATCTGCAGCTGATTGGG - Intronic
931875930 2:66512245-66512267 CATGATATTTGTGGCTACTTTGG - Exonic
933342200 2:81038019-81038041 CCTGATATCTGTGTCTGATTGGG - Intergenic
934867172 2:97823863-97823885 CCTGTTATCTGTGGCTGATTGGG - Intronic
936052051 2:109231397-109231419 CCTTAGATCTGTGCCTGGTTGGG + Intronic
938222490 2:129582168-129582190 GCTGATATCTGCTGCTGATGAGG + Intergenic
938806141 2:134808641-134808663 CCTGATATCTGCAGCTGATTGGG + Intergenic
939393235 2:141595420-141595442 TCTGATATAAGAGGCTGATTTGG - Intronic
939851899 2:147314147-147314169 TCTGATATCTGTGGTTGATTGGG - Intergenic
940762011 2:157749243-157749265 CAGTATATTTGTGGCTGATTTGG + Intronic
941753342 2:169157531-169157553 ACTGTTATTTGTGGCTGATCTGG - Intronic
942823417 2:180143772-180143794 CCTGTTATCTGTGGCACATGAGG - Intergenic
943103028 2:183510199-183510221 CCTGTTATCTGTGGCTGATTTGG + Intergenic
943976593 2:194486565-194486587 CATGAAGTCTGTGGCAGATTTGG + Intergenic
944729043 2:202499677-202499699 CCTGGTATCTGTGGCTGATTGGG - Intronic
946207320 2:218119172-218119194 CCTGATATCTGCAGCTGATTGGG + Intergenic
946670014 2:222092470-222092492 CCTGCTCTATGTGGCTGCTTGGG - Intergenic
947175563 2:227363569-227363591 TCTCATATCAGTGGTTGATTTGG - Exonic
1169723583 20:8704682-8704704 CATATTATCTGTGGCTGCTTTGG + Intronic
1169902398 20:10566837-10566859 CCTGAAGTCTGTGGATGATGTGG + Intronic
1170044612 20:12072094-12072116 CCTGATACCTGTGAATCATTTGG + Intergenic
1170114242 20:12839417-12839439 CCTGGTAGCTGTGGCTCCTTAGG - Intergenic
1170833913 20:19867671-19867693 CCTGATATCTGGGACTGAGGAGG - Intergenic
1171261548 20:23738688-23738710 CCTGATGTCTGCAGCTGATTGGG - Intergenic
1171270690 20:23814579-23814601 CCTGATGTCTGCAGCTGATTGGG - Intergenic
1172340693 20:34155194-34155216 CTTGATATCTGTGGCTGATTGGG - Intergenic
1177135112 21:17299544-17299566 CCTGATATCTGCAGCTGATTGGG - Intergenic
1178153240 21:29820544-29820566 CGTGAGATGTGTGGCTAATTAGG + Intronic
1178174948 21:30085964-30085986 TCTGATATCTATGGTAGATTTGG - Intergenic
1179729473 21:43359609-43359631 CCTGATACCTTTGGCTGAAATGG - Intergenic
1183639433 22:39084088-39084110 CCTGAGACATGTGGCTGGTTAGG - Intronic
949747375 3:7310679-7310701 CCTGCTATTTGTGGCAGAGTGGG + Intronic
951020529 3:17777232-17777254 CCTGATATCTGTGGCTGATTGGG - Intronic
951239512 3:20272446-20272468 CTTGATATCTGCAGCTGATTGGG - Intergenic
951919825 3:27842136-27842158 CCTTATATCAGGGGCTGCTTTGG + Intergenic
952453068 3:33449408-33449430 CCTGATATCTGTGGCTGATTGGG - Intergenic
952555005 3:34521540-34521562 ACTGATATCTGTGGCTGATTGGG + Intergenic
952940906 3:38443688-38443710 CCTGATATCTGTGACTGATTGGG + Intergenic
952972320 3:38659383-38659405 CCTGGGAGTTGTGGCTGATTGGG - Intergenic
953622897 3:44548156-44548178 CCTGACATCTGGGGCTGACTGGG + Intergenic
953756664 3:45652373-45652395 TCTAATATCTGTGTCTGATCGGG + Intronic
954232227 3:49226310-49226332 CCTGATATCTGCAACTGATTGGG + Intronic
954587019 3:51745093-51745115 CCTGATATCTGCAGCTGACTGGG - Intergenic
954598962 3:51852927-51852949 CCTGATATCTGCAGCTGATTAGG - Intergenic
956842918 3:73156737-73156759 CCTGATATCTGTGGCTGATTGGG + Intergenic
956845128 3:73175520-73175542 GCTGATATCTATGGCTGACAGGG + Intergenic
956930819 3:74040812-74040834 CCTGGTTTCTGTAGCTGCTTTGG + Intergenic
958001566 3:87756942-87756964 CCTGGTATCTGTGGCTCCTAAGG - Intergenic
958549179 3:95592716-95592738 CTGATTATCTGTGGCTGATTGGG + Intergenic
958601425 3:96300549-96300571 CCTGATATCTGCGGCTGATTGGG - Intergenic
960063729 3:113349289-113349311 CCTGATACCTGTGGCTGACTGGG - Intronic
961261706 3:125607130-125607152 CCTGGTATCTGCGGCTGATTGGG - Intergenic
963021290 3:140875113-140875135 CCTGATATCCACAGCTGATTGGG - Intergenic
963404593 3:144846168-144846190 CCTTATAACTGGGGCTGCTTTGG + Intergenic
963409181 3:144907097-144907119 TCTGATCTCTATGGCTAATTGGG + Intergenic
963696790 3:148573602-148573624 CCTGATATCTGTGGCTGATTGGG - Intergenic
963721964 3:148871749-148871771 TCCCATAACTGTGGCTGATTTGG - Intronic
963992254 3:151668172-151668194 CCTGATATCTGTGGCTGATTGGG + Intergenic
964972269 3:162577289-162577311 CCTGATATTTGCGGCTGATTGGG - Intergenic
965062784 3:163804352-163804374 CCTGATATCTGTGGCTGACTGGG - Intergenic
967583649 3:191188206-191188228 CCTGATATCTGCAGCTGATTGGG - Intergenic
970498647 4:16654042-16654064 CTTGATATCTGTGATTAATTTGG - Intronic
970556169 4:17234865-17234887 CCTCATATTTTTAGCTGATTTGG + Intergenic
970667664 4:18355963-18355985 CTTGATATCTATGGGGGATTGGG + Intergenic
970739166 4:19212943-19212965 TCTGAAATCTGTCTCTGATTTGG - Intergenic
971281171 4:25243612-25243634 CCTGATATCTGTGGCTGATTGGG + Intronic
971307086 4:25492727-25492749 TCTGATATCTTTGTCTGGTTTGG - Intergenic
971578506 4:28305782-28305804 CCTGATATCTGTGGCTGATTGGG - Intergenic
972133260 4:35862380-35862402 CCTGATATCTGTGGCTGATTGGG + Intergenic
973045895 4:45534222-45534244 CCTGATATCTGTGGCTGATAGGG - Intergenic
974174534 4:58307124-58307146 CCTGATATCTGTGGCTGGATTGG - Intergenic
974187350 4:58460866-58460888 CCTGATATCTGTGGCTGATTGGG - Intergenic
974526585 4:63055619-63055641 CCTGATATATGTGGCTGATTGGG - Intergenic
974537170 4:63187405-63187427 CCTGATATCTGTGGCTGACTGGG - Intergenic
974838827 4:67279531-67279553 CCTGATATCTGTGGCTGATTGGG + Intergenic
975048028 4:69827611-69827633 CTTGATATCTGTGGCTGACTGGG - Intronic
975595800 4:76047413-76047435 CCTGATATCTGCGGCTGATTGGG + Intronic
975637614 4:76465721-76465743 CTTGATTTCTGTGTCTGTTTAGG - Intronic
976174282 4:82336269-82336291 CCTGATATCTGCGGCTGATTGGG + Intergenic
977834892 4:101635502-101635524 TCTGATATCTGCATCTGATTGGG + Intronic
977884122 4:102238073-102238095 CCTGATATCTGCAGCTGATTGGG - Intergenic
980001847 4:127498370-127498392 AGTGGTATCTGTGGCTGATCAGG + Intergenic
981753934 4:148120656-148120678 CTGGATATCTGTGGCTGAAAAGG - Intronic
982664833 4:158249221-158249243 TCTGATATCTGTTACTCATTGGG + Intronic
982701159 4:158660755-158660777 TCTGATATCTGCTGCTGATTGGG - Intergenic
982877326 4:160665125-160665147 CCTGATGTCTGTGGCTCATTGGG - Intergenic
983027843 4:162759130-162759152 CCTGTCACCTGTGGCTGGTTTGG - Intergenic
983367332 4:166809729-166809751 CCTGATAGCTGGAGATGATTGGG + Intronic
983462092 4:168038540-168038562 ATTGATATCTGTTGGTGATTTGG + Intergenic
983834901 4:172374398-172374420 CCTGATATCTGCAGCTGATTGGG + Intronic
984917483 4:184737209-184737231 CCTGATATCTGCAACTGATTGGG - Intergenic
985635094 5:1031973-1031995 CCTAAAATCTGAGGCTGAGTGGG + Intronic
986933341 5:12854239-12854261 CCTGATATCTGCAGCTGATTGGG - Intergenic
987401983 5:17487232-17487254 CCTGAAATCTGTGCCTGAGCAGG + Intergenic
987545205 5:19304547-19304569 CCTGATATCTGCAGCTGATTGGG + Intergenic
987929921 5:24389932-24389954 TCTGATATGTGTGGCTGATTGGG - Intergenic
988357828 5:30200380-30200402 CCTGATATCTGTGGCTGATTGGG - Intergenic
988591985 5:32557088-32557110 CCTGATATCTGTGGCTGATTGGG + Intronic
988605470 5:32675209-32675231 CCTGATATCTGTGGCTGATTGGG + Intergenic
989545357 5:42666089-42666111 CCTGAAAACTGTTGCTGAATCGG - Intronic
989957379 5:50373111-50373133 CCTGATATCTGCGGCTTATTGGG - Intergenic
989964335 5:50450815-50450837 CCTGATATCTGCGGCTGATTGGG + Intergenic
990033579 5:51291985-51292007 CCTGATATCTGTGGTATATCAGG + Intergenic
990116763 5:52400071-52400093 TCTGATATCTGTGGCTGATTGGG - Intergenic
990367837 5:55088401-55088423 CCTGATATCTGTGACTGACTGGG + Intergenic
991996224 5:72389987-72390009 CCTGAAATCTGTGGCTTACTAGG + Intergenic
992049390 5:72929083-72929105 CCTGATATCTGCAGCTGACTGGG - Intergenic
992455228 5:76910272-76910294 CCTGATATCTGCTGCAGATTGGG - Intronic
992545803 5:77812787-77812809 CCTGATATCTGCAGCTGATTAGG - Intronic
994231704 5:97315501-97315523 CCTGATATCTGCAGCTGATTGGG + Intergenic
995583394 5:113623030-113623052 CCTGATGTCTGTGGCTGATTGGG + Intergenic
995706461 5:114993160-114993182 CCTGACATCTGTGGCTGATTGGG - Intergenic
996099201 5:119430073-119430095 CCTGATATCTGTGGCTGATTGGG + Intergenic
996470693 5:123856855-123856877 CTTCACATCTGTGGCTGATGTGG - Intergenic
996520564 5:124421127-124421149 CCAGAGGTCTGTGGCTGATGTGG - Intergenic
997072425 5:130636369-130636391 CCTGATATCTGCAGCTGATTGGG - Intergenic
997574671 5:134965409-134965431 CCGGCTATCTGTGGCTGAGATGG + Exonic
998111486 5:139506102-139506124 CCTGATATCTGTGGCTGATTGGG - Intergenic
1000085254 5:157882796-157882818 CCTGATATCTGTGACTGATTGGG - Intergenic
1000319543 5:160123218-160123240 CATGATATTTGTGGCTGACTAGG + Intergenic
1003805810 6:9725074-9725096 CCTGGTATCTGCAGCTGATCGGG - Intronic
1006221807 6:32497802-32497824 CCTGATTCCTGTGGCTAATTGGG - Intergenic
1006611804 6:35298523-35298545 CCTGATATGTGTGGTGGATAGGG - Intronic
1007030060 6:38619190-38619212 CCTGATATCCGTGGCTGACTGGG - Intronic
1007520464 6:42448155-42448177 CCTGCTTTCTGTGGGTAATTGGG - Intronic
1009385914 6:63084020-63084042 CCTGATATCTGTGGCTGACTGGG + Intergenic
1009407683 6:63330456-63330478 CCTGATATCTGCGGCTGATTAGG + Intergenic
1009470826 6:64027401-64027423 CCTGATATCTGTGGCTGATTGGG - Intronic
1010269842 6:73906570-73906592 CCTGATATCTGCAGCTGATTGGG - Intergenic
1010561582 6:77357750-77357772 CCTGGTAGATGTGGCTGTTTCGG + Intergenic
1011375022 6:86678610-86678632 CCTGATATCTGTGGCTGATTGGG + Intergenic
1012441533 6:99266036-99266058 CCTGATATCTGCAGCTGATTGGG + Intergenic
1012611584 6:101226378-101226400 GCTGGCATTTGTGGCTGATTTGG - Intergenic
1013907826 6:115238370-115238392 ACTGATATCTGCTGCTGATTGGG + Intergenic
1013977444 6:116093860-116093882 CCTGATATCTGTGGCTGATTGGG - Intergenic
1016184053 6:141178940-141178962 CCTGATATCTGCAGCTGATTGGG - Intergenic
1021356563 7:19658265-19658287 CCTGATAACTGTTGCTGATTGGG + Intergenic
1021756710 7:23859321-23859343 CCTGATGTCTGCGGCTGATTGGG + Intergenic
1022670795 7:32453624-32453646 CCTGAGATATGTGGCTAAGTGGG - Intergenic
1023077941 7:36501985-36502007 CCTGATATCTGTGGCTAATTGGG + Intergenic
1024870767 7:53959934-53959956 CCTGATATCTGCGGCTGATTGGG + Intergenic
1027791137 7:82639855-82639877 CCTGATATCTGCAGCTGATTGGG - Intergenic
1028495208 7:91453548-91453570 CCTGATATCTGCAGCTAATTGGG + Intergenic
1030420532 7:109301974-109301996 CCTGATATCTGCAGCTGATTGGG - Intergenic
1031118663 7:117695676-117695698 CCTGATATAACTGGCTGATCTGG + Intronic
1031482361 7:122293920-122293942 CCTGACATCTTTGTCAGATTGGG + Intergenic
1031731796 7:125310600-125310622 CCTGATATCCGCTGCTGATTGGG - Intergenic
1031979741 7:128116843-128116865 CCTGACAGCTGTGGCTGGTGTGG + Intergenic
1032022160 7:128413735-128413757 GCTCTTATCTGTGGCTGCTTTGG + Intergenic
1033200665 7:139366601-139366623 CATGATGTCTATGGCTGCTTTGG + Intronic
1033759231 7:144422148-144422170 CCTGATATCTGCAGCTGATTGGG + Intergenic
1034579963 7:152033504-152033526 CCTGATATCCACGGCTGATTGGG + Intronic
1034921695 7:155088451-155088473 CCTGATCTCTGGGGCAGATTTGG - Intergenic
1035718185 8:1769972-1769994 CCTGAATTGTGTGACTGATTGGG - Intronic
1035718270 8:1770609-1770631 CCTGAATTGTGTGACTGATTGGG + Intronic
1038430766 8:27497615-27497637 CCTGATATCTGCGGCTGATTGGG + Intronic
1038638803 8:29307757-29307779 CCTGATATCTGCGGCTGATTGGG - Intergenic
1039025717 8:33255737-33255759 CCTGATTTCTCTGCCTGATATGG - Intergenic
1039276023 8:35934782-35934804 CCTGATATCTGTGGCTGATTGGG - Intergenic
1039693160 8:39882717-39882739 TCTGTTATCTGCAGCTGATTGGG + Intergenic
1039999665 8:42565379-42565401 CCTGTTATCTGCAGCTGAATGGG + Intergenic
1040527229 8:48235820-48235842 CCTGATATCTGTGGCTGATTTGG - Intergenic
1040648969 8:49429104-49429126 CCTGATATCTGCAGCTGATTGGG - Intergenic
1040667854 8:49654226-49654248 CCTGGTATCTGCAGCTGATTGGG + Intergenic
1040925567 8:52678637-52678659 GCTGATATATTTGGCTGATAAGG + Intronic
1040965044 8:53074316-53074338 CCTGATATTTGTGGTTGATTGGG + Intergenic
1040971440 8:53140801-53140823 CCTGATATCTGCAGCTGATTGGG + Intergenic
1040999919 8:53440083-53440105 CCTGATATCTGTGGCTGATTGGG + Intergenic
1041001921 8:53462360-53462382 CCTGATTTCTGTGGCTGATTGGG - Intergenic
1042632874 8:70839917-70839939 CCTGATAGCTTTGGCTGGGTAGG + Intergenic
1042771929 8:72390730-72390752 CCTGATATCTGCGGTTGATTGGG - Intergenic
1042855698 8:73264823-73264845 CCAGATATCTGTGGCTACTCTGG - Intergenic
1042919627 8:73908792-73908814 CCTGATATCTGTGGTTGATTGGG - Intergenic
1043257071 8:78150354-78150376 CCTGATATCTGCAGCTTATTGGG - Intergenic
1044005420 8:86931740-86931762 CCTGGTACCTGTGGCTGATTCGG + Intronic
1044456617 8:92398113-92398135 CCTGATATCTGCGGCTGATTGGG + Intergenic
1044893236 8:96859774-96859796 CATGATGTCTGTGGCTTATTTGG + Intronic
1045281838 8:100756069-100756091 GCTGATATCTGCTGCTCATTTGG + Intergenic
1048951837 8:139502749-139502771 ACTGGTATATGTGACTGATTGGG + Intergenic
1051094857 9:13455149-13455171 GCTGATTTCTCTGGGTGATTTGG - Intergenic
1051392574 9:16581786-16581808 ACTGAGACCTGTTGCTGATTTGG + Intronic
1051955937 9:22693389-22693411 CCTGATGTCTCTAGCTTATTTGG + Intergenic
1052057760 9:23923095-23923117 CCTGATATCTGCAGCTGATTGGG + Intergenic
1052289504 9:26826133-26826155 CCTGATATCTGCGGTTGATTGGG - Intergenic
1053474649 9:38373267-38373289 CCTGATATCTGTGGATGAGTTGG - Intergenic
1055458262 9:76492966-76492988 CCTGACATCTGCAGCTGATTGGG + Intronic
1056392769 9:86154499-86154521 CCTGATATCTGTGGCTGATTGGG + Intergenic
1056396334 9:86184806-86184828 TCTAATATCTGATGCTGATTAGG + Intergenic
1056559079 9:87714233-87714255 CATGATATATGTGGCTTTTTGGG + Intergenic
1186628917 X:11326944-11326966 CATGAAATCAGTGGATGATTGGG - Intronic
1188097535 X:26042891-26042913 CCTGATATCTGTGGCTGATTGGG - Intergenic
1188136530 X:26500248-26500270 CCTGATATCTGTGGCTGATTGGG - Intergenic
1189613799 X:42764579-42764601 CCGGATATCTGGGGAGGATTGGG - Intergenic
1190072666 X:47291829-47291851 CCAGATATCTGGGGCAGATTGGG + Intergenic
1190541476 X:51482396-51482418 CCTGATATCCACGGCTGATTGGG - Intergenic
1191903799 X:66066082-66066104 GCTGGTTTCTGTGGCTAATTGGG + Intergenic
1192482747 X:71499416-71499438 CCTGATATCTGCAGCTGATTGGG + Intronic
1192573204 X:72223004-72223026 CTGGATATCTGGGGCAGATTGGG - Intronic
1192870000 X:75175975-75175997 CCTGATATCTGCGGCTGATTGGG + Intergenic
1193525905 X:82588773-82588795 CCTGAGATGTGTGGGTGATGTGG + Intergenic
1194023681 X:88725080-88725102 GCTGATATCTTTGTCTGTTTGGG - Intergenic
1195166281 X:102223795-102223817 AGTGATGTCTGTGGCTGCTTTGG - Exonic
1195192579 X:102463293-102463315 AGTGATGTCTGTGGCTGCTTTGG + Exonic
1195439582 X:104885529-104885551 CCTGATATCTGCGGCTGATTGGG - Intronic
1195552372 X:106184238-106184260 CCTGATACCTGGGGCTGATTGGG + Intronic
1196127337 X:112114019-112114041 CCTGATATCTGTGGCTGATTGGG + Intergenic
1196419370 X:115506857-115506879 CCTGATATCTGTGGCTGATTGGG + Intergenic
1196488997 X:116246278-116246300 CCTGATATCTGTGGCTGATTGGG - Intergenic
1198017122 X:132622373-132622395 TCTGGTGTCTCTGGCTGATTGGG - Intergenic
1200694963 Y:6350660-6350682 CTTGATATCTTCAGCTGATTGGG + Intergenic
1200711285 Y:6487070-6487092 CCTGATATCTGCAGCTGATTGGG - Intergenic
1200776227 Y:7172565-7172587 TCTGATATCTCTGGCTGATTGGG - Intergenic
1200880792 Y:8209634-8209656 CCCAATATCTGTGGTGGATTGGG + Intergenic
1200945332 Y:8830103-8830125 CCTGATATCTGTGGCTGATTGGG - Intergenic
1200959320 Y:8982644-8982666 ACTGATATCTGGGTCTGATTGGG - Intergenic
1200966777 Y:9046062-9046084 CCTGATATCTGTGGCTGATTGGG - Intergenic
1201022649 Y:9674916-9674938 CCTGATATCTGCAGCTGATTGGG + Intergenic
1201040314 Y:9824050-9824072 CTTGATATCTTCAGCTGATTGGG - Intergenic
1201271929 Y:12263928-12263950 CCTCATATCTGCAGCTGATTGGG + Intergenic
1201312042 Y:12605943-12605965 CCTGATATCTGCAACTGATTTGG + Intergenic
1201403771 Y:13630586-13630608 CCTGGTATCTGTTGCTGATTGGG - Intergenic
1201429705 Y:13891726-13891748 CCTGATATCTGCAGCTGATTGGG - Intergenic
1201455131 Y:14161011-14161033 CCTGATCTCTGCAGCTGATTAGG - Intergenic
1201473158 Y:14355158-14355180 CCTGATATCTGCAGCTGACTGGG + Intergenic
1201487591 Y:14509095-14509117 CCTGATATCTGCAGTTGATTGGG - Intergenic
1201530558 Y:14986234-14986256 CCTGACATCTTTGGCTGATTGGG - Intergenic
1201555745 Y:15263496-15263518 TCTGATATCTGTGGCTGATTGGG - Intergenic
1201568574 Y:15391049-15391071 CCTGATATCTGTGGCTCACTGGG + Intergenic
1201631267 Y:16074033-16074055 CCTGATATCTGCAGCTGATTGGG - Intergenic
1201648878 Y:16264125-16264147 CCTGATATCTGTGGCTGATTGGG + Intergenic
1201653931 Y:16321175-16321197 CCTGATATCTGTGGCTGATTGGG - Intergenic
1201729588 Y:17189861-17189883 CTTGATATCTGCAGCTGATTGGG + Intergenic
1201743985 Y:17351169-17351191 CCTGATACCTGTGGCTGATTTGG + Intergenic
1201908214 Y:19106442-19106464 CCTGATGTCTGTTACTGATTGGG + Intergenic
1201911105 Y:19134321-19134343 CCTGATAGCTGTGCCTGATTGGG - Intergenic
1201989504 Y:20008709-20008731 CTTGATATCTGCAGCTGATTGGG + Intergenic
1202074694 Y:21026334-21026356 CCTGATATCCACAGCTGATTGGG + Intergenic
1202089868 Y:21178244-21178266 TCTCATATCTGCAGCTGATTGGG + Intergenic
1202146681 Y:21806110-21806132 CCTGATATCTGTGGCTGATTGGG + Intergenic
1202192598 Y:22260126-22260148 CCTGATATCTGCTGCTGATTGGG + Intergenic
1202242894 Y:22788927-22788949 CCTGATATCTGTGGCTGATTGGG - Intergenic
1202257834 Y:22939786-22939808 CCTGATGTCTGTGGCTGATTGGG - Intergenic
1202272046 Y:23082151-23082173 CCTGATAGCTGTGGCTGATTGGG + Intergenic
1202293980 Y:23338531-23338553 CCTGATAGCTGTGGCTGATTGGG - Intergenic
1202395881 Y:24422677-24422699 CCTGATATCTGTGGCTGATTGGG - Intergenic
1202410824 Y:24573533-24573555 CCTGATGTCTGTGGCTGATTGGG - Intergenic
1202425043 Y:24715895-24715917 CCTGATAGCTGTGGCTGATTGGG + Intergenic
1202445746 Y:24954190-24954212 CCTGATAGCTGTGGCTGATTGGG - Intergenic
1202459957 Y:25096539-25096561 CCTGATGTCTGTGGCTGATTGGG + Intergenic
1202474904 Y:25247415-25247437 CCTGATATCTGTGGCTGATTGGG + Intergenic