ID: 1201653937

View in Genome Browser
Species Human (GRCh38)
Location Y:16321206-16321228
Sequence CAGGTCCCAGGGCTCACTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201653937_1201653943 7 Left 1201653937 Y:16321206-16321228 CCAAAAGTGAGCCCTGGGACCTG No data
Right 1201653943 Y:16321236-16321258 TCTGGAGGCATTATTAAACCTGG 0: 104
1: 99
2: 51
3: 26
4: 120
1201653937_1201653945 29 Left 1201653937 Y:16321206-16321228 CCAAAAGTGAGCCCTGGGACCTG No data
Right 1201653945 Y:16321258-16321280 GCAATCTCAGTGTTCTAAACAGG No data
1201653937_1201653941 -8 Left 1201653937 Y:16321206-16321228 CCAAAAGTGAGCCCTGGGACCTG No data
Right 1201653941 Y:16321221-16321243 GGGACCTGAACAAAATCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201653937 Original CRISPR CAGGTCCCAGGGCTCACTTT TGG (reversed) Intergenic
No off target data available for this crispr