ID: 1201653941

View in Genome Browser
Species Human (GRCh38)
Location Y:16321221-16321243
Sequence GGGACCTGAACAAAATCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201653931_1201653941 23 Left 1201653931 Y:16321175-16321197 CCCAATCAGCCACAGATATCAGG 0: 56
1: 61
2: 80
3: 50
4: 157
Right 1201653941 Y:16321221-16321243 GGGACCTGAACAAAATCTGGAGG No data
1201653933_1201653941 22 Left 1201653933 Y:16321176-16321198 CCAATCAGCCACAGATATCAGGA 0: 59
1: 58
2: 80
3: 64
4: 179
Right 1201653941 Y:16321221-16321243 GGGACCTGAACAAAATCTGGAGG No data
1201653937_1201653941 -8 Left 1201653937 Y:16321206-16321228 CCAAAAGTGAGCCCTGGGACCTG No data
Right 1201653941 Y:16321221-16321243 GGGACCTGAACAAAATCTGGAGG No data
1201653934_1201653941 14 Left 1201653934 Y:16321184-16321206 CCACAGATATCAGGAGAAAGCTC 0: 75
1: 53
2: 28
3: 36
4: 224
Right 1201653941 Y:16321221-16321243 GGGACCTGAACAAAATCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201653941 Original CRISPR GGGACCTGAACAAAATCTGG AGG Intergenic
No off target data available for this crispr