ID: 1201658880

View in Genome Browser
Species Human (GRCh38)
Location Y:16378859-16378881
Sequence CAAAATGCTGGTGGTGTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201658876_1201658880 9 Left 1201658876 Y:16378827-16378849 CCTTGAAGATTACTCAGTCTTTA No data
Right 1201658880 Y:16378859-16378881 CAAAATGCTGGTGGTGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201658880 Original CRISPR CAAAATGCTGGTGGTGTTAC TGG Intergenic
No off target data available for this crispr