ID: 1201658993

View in Genome Browser
Species Human (GRCh38)
Location Y:16379710-16379732
Sequence CTCTCTAAACTAATCCTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201658989_1201658993 1 Left 1201658989 Y:16379686-16379708 CCCATTGGCCAGGGTCGGGTCAT No data
Right 1201658993 Y:16379710-16379732 CTCTCTAAACTAATCCTGGTTGG No data
1201658985_1201658993 7 Left 1201658985 Y:16379680-16379702 CCTTTCCCCATTGGCCAGGGTCG 0: 9
1: 18
2: 33
3: 47
4: 212
Right 1201658993 Y:16379710-16379732 CTCTCTAAACTAATCCTGGTTGG No data
1201658978_1201658993 19 Left 1201658978 Y:16379668-16379690 CCCCGTATGTACCCTTTCCCCAT No data
Right 1201658993 Y:16379710-16379732 CTCTCTAAACTAATCCTGGTTGG No data
1201658977_1201658993 23 Left 1201658977 Y:16379664-16379686 CCTGCCCCGTATGTACCCTTTCC No data
Right 1201658993 Y:16379710-16379732 CTCTCTAAACTAATCCTGGTTGG No data
1201658984_1201658993 8 Left 1201658984 Y:16379679-16379701 CCCTTTCCCCATTGGCCAGGGTC 0: 12
1: 26
2: 31
3: 34
4: 202
Right 1201658993 Y:16379710-16379732 CTCTCTAAACTAATCCTGGTTGG No data
1201658990_1201658993 0 Left 1201658990 Y:16379687-16379709 CCATTGGCCAGGGTCGGGTCATA No data
Right 1201658993 Y:16379710-16379732 CTCTCTAAACTAATCCTGGTTGG No data
1201658991_1201658993 -7 Left 1201658991 Y:16379694-16379716 CCAGGGTCGGGTCATACTCTCTA No data
Right 1201658993 Y:16379710-16379732 CTCTCTAAACTAATCCTGGTTGG No data
1201658988_1201658993 2 Left 1201658988 Y:16379685-16379707 CCCCATTGGCCAGGGTCGGGTCA No data
Right 1201658993 Y:16379710-16379732 CTCTCTAAACTAATCCTGGTTGG No data
1201658980_1201658993 17 Left 1201658980 Y:16379670-16379692 CCGTATGTACCCTTTCCCCATTG No data
Right 1201658993 Y:16379710-16379732 CTCTCTAAACTAATCCTGGTTGG No data
1201658979_1201658993 18 Left 1201658979 Y:16379669-16379691 CCCGTATGTACCCTTTCCCCATT No data
Right 1201658993 Y:16379710-16379732 CTCTCTAAACTAATCCTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201658993 Original CRISPR CTCTCTAAACTAATCCTGGT TGG Intergenic
No off target data available for this crispr