ID: 1201662433

View in Genome Browser
Species Human (GRCh38)
Location Y:16414220-16414242
Sequence GAAGAGTCCCAGTACTAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201662428_1201662433 6 Left 1201662428 Y:16414191-16414213 CCTGACCCTTGGGGGACACCCTA No data
Right 1201662433 Y:16414220-16414242 GAAGAGTCCCAGTACTAACCAGG No data
1201662422_1201662433 30 Left 1201662422 Y:16414167-16414189 CCATGAGCTTTGAGCACAATAGG No data
Right 1201662433 Y:16414220-16414242 GAAGAGTCCCAGTACTAACCAGG No data
1201662429_1201662433 1 Left 1201662429 Y:16414196-16414218 CCCTTGGGGGACACCCTAAGAGA No data
Right 1201662433 Y:16414220-16414242 GAAGAGTCCCAGTACTAACCAGG No data
1201662430_1201662433 0 Left 1201662430 Y:16414197-16414219 CCTTGGGGGACACCCTAAGAGAA No data
Right 1201662433 Y:16414220-16414242 GAAGAGTCCCAGTACTAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201662433 Original CRISPR GAAGAGTCCCAGTACTAACC AGG Intergenic
No off target data available for this crispr