ID: 1201663153

View in Genome Browser
Species Human (GRCh38)
Location Y:16419731-16419753
Sequence GTGGATAAGTTCCACTATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201663153_1201663160 7 Left 1201663153 Y:16419731-16419753 CCCAGATAGTGGAACTTATCCAC No data
Right 1201663160 Y:16419761-16419783 CTAAACACCACCAAATTAATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201663153 Original CRISPR GTGGATAAGTTCCACTATCT GGG (reversed) Intergenic
No off target data available for this crispr