ID: 1201667519

View in Genome Browser
Species Human (GRCh38)
Location Y:16475187-16475209
Sequence GTTCTTGAGGGTATTGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201667513_1201667519 -7 Left 1201667513 Y:16475171-16475193 CCCTGAGGAGTTCTGGGTTCTTG No data
Right 1201667519 Y:16475187-16475209 GTTCTTGAGGGTATTGTGGAGGG No data
1201667508_1201667519 8 Left 1201667508 Y:16475156-16475178 CCCTCAAGTTCACTTCCCTGAGG No data
Right 1201667519 Y:16475187-16475209 GTTCTTGAGGGTATTGTGGAGGG No data
1201667510_1201667519 7 Left 1201667510 Y:16475157-16475179 CCTCAAGTTCACTTCCCTGAGGA No data
Right 1201667519 Y:16475187-16475209 GTTCTTGAGGGTATTGTGGAGGG No data
1201667514_1201667519 -8 Left 1201667514 Y:16475172-16475194 CCTGAGGAGTTCTGGGTTCTTGA No data
Right 1201667519 Y:16475187-16475209 GTTCTTGAGGGTATTGTGGAGGG No data
1201667506_1201667519 29 Left 1201667506 Y:16475135-16475157 CCAGACCACATCAAGAGGAGGCC No data
Right 1201667519 Y:16475187-16475209 GTTCTTGAGGGTATTGTGGAGGG No data
1201667507_1201667519 24 Left 1201667507 Y:16475140-16475162 CCACATCAAGAGGAGGCCCTCAA No data
Right 1201667519 Y:16475187-16475209 GTTCTTGAGGGTATTGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201667519 Original CRISPR GTTCTTGAGGGTATTGTGGA GGG Intergenic
No off target data available for this crispr