ID: 1201668931

View in Genome Browser
Species Human (GRCh38)
Location Y:16493256-16493278
Sequence TCCGTAGGGTACCCAAAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201668931_1201668938 19 Left 1201668931 Y:16493256-16493278 CCAGACTTTGGGTACCCTACGGA No data
Right 1201668938 Y:16493298-16493320 CAACAGTCCAAGCCAGCATTAGG No data
1201668931_1201668936 -8 Left 1201668931 Y:16493256-16493278 CCAGACTTTGGGTACCCTACGGA No data
Right 1201668936 Y:16493271-16493293 CCTACGGATGGTGTTGAGGCTGG 0: 3
1: 16
2: 23
3: 18
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201668931 Original CRISPR TCCGTAGGGTACCCAAAGTC TGG (reversed) Intergenic
No off target data available for this crispr