ID: 1201668938

View in Genome Browser
Species Human (GRCh38)
Location Y:16493298-16493320
Sequence CAACAGTCCAAGCCAGCATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201668934_1201668938 5 Left 1201668934 Y:16493270-16493292 CCCTACGGATGGTGTTGAGGCTG No data
Right 1201668938 Y:16493298-16493320 CAACAGTCCAAGCCAGCATTAGG No data
1201668929_1201668938 22 Left 1201668929 Y:16493253-16493275 CCACCAGACTTTGGGTACCCTAC No data
Right 1201668938 Y:16493298-16493320 CAACAGTCCAAGCCAGCATTAGG No data
1201668931_1201668938 19 Left 1201668931 Y:16493256-16493278 CCAGACTTTGGGTACCCTACGGA No data
Right 1201668938 Y:16493298-16493320 CAACAGTCCAAGCCAGCATTAGG No data
1201668935_1201668938 4 Left 1201668935 Y:16493271-16493293 CCTACGGATGGTGTTGAGGCTGG No data
Right 1201668938 Y:16493298-16493320 CAACAGTCCAAGCCAGCATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201668938 Original CRISPR CAACAGTCCAAGCCAGCATT AGG Intergenic
No off target data available for this crispr