ID: 1201677439

View in Genome Browser
Species Human (GRCh38)
Location Y:16603247-16603269
Sequence GAAGCTTGGTCTTTGCTAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201677439_1201677443 17 Left 1201677439 Y:16603247-16603269 CCCATTAGCAAAGACCAAGCTTC No data
Right 1201677443 Y:16603287-16603309 ATTGCCCATCTGTAATATCCAGG No data
1201677439_1201677444 20 Left 1201677439 Y:16603247-16603269 CCCATTAGCAAAGACCAAGCTTC No data
Right 1201677444 Y:16603290-16603312 GCCCATCTGTAATATCCAGGTGG No data
1201677439_1201677447 28 Left 1201677439 Y:16603247-16603269 CCCATTAGCAAAGACCAAGCTTC No data
Right 1201677447 Y:16603298-16603320 GTAATATCCAGGTGGATACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201677439 Original CRISPR GAAGCTTGGTCTTTGCTAAT GGG (reversed) Intergenic
No off target data available for this crispr