ID: 1201687107

View in Genome Browser
Species Human (GRCh38)
Location Y:16717416-16717438
Sequence CAAGACTGCTTGGCAGATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201687103_1201687107 0 Left 1201687103 Y:16717393-16717415 CCTTGGCATAAATATGGTTGACC No data
Right 1201687107 Y:16717416-16717438 CAAGACTGCTTGGCAGATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201687107 Original CRISPR CAAGACTGCTTGGCAGATAT TGG Intergenic
No off target data available for this crispr