ID: 1201692040

View in Genome Browser
Species Human (GRCh38)
Location Y:16778227-16778249
Sequence TTTCAATTCAGTGTCTATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201692031_1201692040 12 Left 1201692031 Y:16778192-16778214 CCTACATGGCGTGATGCTTCCCT No data
Right 1201692040 Y:16778227-16778249 TTTCAATTCAGTGTCTATGAGGG No data
1201692033_1201692040 -7 Left 1201692033 Y:16778211-16778233 CCCTTCACCCCAGGCCTTTCAAT No data
Right 1201692040 Y:16778227-16778249 TTTCAATTCAGTGTCTATGAGGG No data
1201692030_1201692040 18 Left 1201692030 Y:16778186-16778208 CCTGTACCTACATGGCGTGATGC No data
Right 1201692040 Y:16778227-16778249 TTTCAATTCAGTGTCTATGAGGG No data
1201692034_1201692040 -8 Left 1201692034 Y:16778212-16778234 CCTTCACCCCAGGCCTTTCAATT No data
Right 1201692040 Y:16778227-16778249 TTTCAATTCAGTGTCTATGAGGG No data
1201692029_1201692040 21 Left 1201692029 Y:16778183-16778205 CCTCCTGTACCTACATGGCGTGA No data
Right 1201692040 Y:16778227-16778249 TTTCAATTCAGTGTCTATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201692040 Original CRISPR TTTCAATTCAGTGTCTATGA GGG Intergenic
No off target data available for this crispr