ID: 1201711740

View in Genome Browser
Species Human (GRCh38)
Location Y:17000233-17000255
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201711736_1201711740 18 Left 1201711736 Y:17000192-17000214 CCTGGTGGTAGAAGATTGGATCA No data
Right 1201711740 Y:17000233-17000255 TAGGATTAGCACCATCTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201711740 Original CRISPR TAGGATTAGCACCATCTTCT TGG Intergenic
No off target data available for this crispr